Functional expression of hMYH, a human homolog of the Escherichia coli MutY protein

Abstract

We have previously described the hMYH cDNA and genomic clones (M. M. Slupska et al., J. Bacteriol. 178:3885-3892, 1996). Here, we report that the enzyme expressed from an hMYH cDNA clone in Escherichia coli complements the mutator phenotype in a mutY mutant and can remove A from an A. 8-hydroxydeoxyguanine mismatch and to a lesser extent can remove A from an A. G mismatch in vitro.

FIG. 1

(A) Sodium dodecyl sulfate-polyacrylamide gel analysis of hMYH purified by Ni²⁺-agarose affinity chromatography, followed by ssDNA-cellulose chromatography (E). The proteins were separated on a 10% polyacrylamide gel in the presence of sodium dodecyl sulfate and stained with Coomassie blue. Lane S, molecular mass standards. Molecular masses, in kilodaltons, are marked on the side. Lane C+, lysate of cells of the CC104 mutY mutant containing pQE30/hMYH; lane C−, lysate of the same strain with pQE30. (B) Western blot analysis of hMYH. Proteins were separated on a 10% polyacrylamide gel, transferred onto a Hybond enhanced chemiluminescence nitrocellulose membrane (Amersham Pharmacia Inc., Piscataway, N.J.), and reacted with antibodies against the histidine tag [anti-RGS(H)₄; Qiagen, Inc.]. Western blotting was performed by enhanced chemiluminescence analysis (ECL; Amersham). Arrows point to the position of full-length hMYH. Lanes C+, C−, and E are as described for panel A.

FIG. 2

Reaction of hMYH and E. coli MutY (EcMY) with different mispair-containing 96-mer templates. Reactions were carried out for 3 h at 37°C; 3 μl of the protein preparation described in the legend to Fig. 1 and 6 ng of E. coli MutY protein were used for all templates. E. coli MutY was purified as described previously (6). The asterisks each indicate an A from a radiolabelled strand. s, substrate; p, product.

FIG. 3

Concentration dependence and time course for the enzymatic reaction of hMYH with A · 8-oxodG placed in a 23-mer (A) and A · G placed in a 45-mer (B). Reaction conditions were as described previously (13). The sequence of the A-containing 23-mer was 5′AGAGGAAAGGAGAGAAGGGAGAG3′. The sequence of the 45-mer for the A-containing strand was 5′TTAGAGCTTGACGGGGAAAGCCAAATTCGGCGAACGTGGCGAGAA3′ (bold A marks the position of the mispaired A for both templates). In the variable-concentration experiment, reaction with A · 8-oxodG was carried out for 10 min, whereas reaction with A · G was carried out for 60 min. In the time course experiment for the A · 8-oxodG substrate, 0.3 μl of the enzyme solution was used, and for the A · G substrate, 1 μl of the enzyme was used. The A-containing oligonucleotide was radiolabelled. S and P, substrate and product, respectively.

FIG. 4

Products generated by hMYH under different conditions of heating. Reactions were stopped by freezing in a dry ice bath (lanes A), loading buffer was added and reaction mixtures were heated for 5 min at 95°C (lanes B), and panels an equal volume of 20% piperidine was added and the reaction mixture was heated for 30 min at 95°C, dried under vacuum, and dissolved in formamide loading buffer (lanes C). Products were resolved on a 15% polyacrylamide–8 M urea gel under conditions described previously (25). Numbers 1 and 2 indicate the enzyme from two different preparations of hMYH. s, migration of substrate; pβ, product of β-elimination; pδ, product of δ-elimination. Samples without enzyme were used for the control. Reactions were carried out with an A · 8-oxodG mispair placed in a 23-mer, with the A-containing strand radiolabelled, for 10 min at 37°C. The sequence of the 23-mer is in the legend to Fig. 3.