Mapping of a hypovirus p29 protease symptom determinant domain with sequence similarity to potyvirus HC-Pro protease

Abstract

Hypovirus infection of the chestnut blight fungus Cryphonectria parasitica results in a spectrum of phenotypic changes that can include alterations in colony morphology and significant reductions in pigmentation, asexual sporulation, and virulence (hypovirulence). Deletion of 88% [Phe(25) to Pro(243)] of the virus-encoded papain-like protease, p29, in the context of an infectious cDNA clone of the prototypic hypovirus CHV1-EP713 (recombinant virus Deltap29) partially relieved virus-mediated suppression of pigmentation and sporulation without altering the level of hypovirulence. We now report mapping of the p29 symptom determinant domain to a region extending from Phe(25) through Gln(73) by a gain-of-function analysis following progressive repair of the Deltap29 deletion mutant. This domain was previously shown to share sequence similarity [including conserved cysteine residues Cys(38), Cys(48), Cys(70), and Cys(72)] with the N-terminal portion of the potyvirus-encoded helper component-proteinase (HC-Pro), a multifunctional protein implicated in aphid-mediated transmission, genome amplification, polyprotein processing, long-distance movement, and suppression of posttranscriptional silencing. Substitution of a glycine residue for either Cys(38) or Cys(48) resulted in no qualitative or quantitative changes in virus-mediated symptoms. Unexpectedly, mutation of Cys(70) resulted in a very severe phenotype that included significantly reduced mycelial growth and profoundly altered colony morphology. In contrast, substitution for Cys(72) resulted in a less severe symptom phenotype approaching that observed for Deltap29. The finding that p29-mediated symptom expression is influenced by two cysteine residues that are conserved in the potyvirus-encoded HC-Pro raises the possibility that these related viral-papain-like proteases function in their respective fungal and plant hosts by impacting ancestrally related regulatory pathways.

FIG. 1

Schematic representation of p29 deletion mutants used for the gain-of-function studies. The basic genome organization of CHV1-EP713 is presented at the top of the figure. ORF A encodes two polypeptides, p29 and p40, that are released from polyprotein p69 by an autocatalytic event mediated by p29. ORF B encodes a large polyprotein that contains an N-terminal papain-like protease, p48, and conserved polymerase and helicase motifs (24). A series of seven variants of Δp29 were constructed to contain progressive extensions of the p29 coding region from Leu(244) toward the N terminus. These mutants were designated p29Δ, followed by the residues that remain deleted. Thus, repair of the Δp29 mutant by extension from Leu(244) to Pro(140) gave mutant virus p29Δ25-139, i.e., which still lacked residues 25 through 139, while the most fully repaired Δp29 mutant, p29Δ25-52, still lacked amino acid residues 25 through 52. DNA fragments used in the construction of mutants were generated by PCR with the following forward primers: MGC107 (GGATCCTGGCCCGTTGTCGCATGGT, corresponding to bases 651 to 669) for p29Δ25-52, NS1 (GGATCCGCGCACCCCTGACGGGGTA, corresponding to bases 684 to 702) for p29Δ25-63, NS2 (GGATCCGGTCCACTTTGAGTTGCCG, corresponding to bases 714 to 732) for p29Δ25-73, NS3 (GGATCCTTCCACCGGAACGGTCCCG, corresponding to bases 750 to 768) for p29Δ25-85, NS4 (GGATCCGGCTGCCTTCATTGGCAGG, corresponding to bases 786 to 804) for p29Δ25-97, MGC109 (GGATCCGGAACAACGTACGAAGGAG, corresponding to bases 822 to 840) for p29Δ25-109, and MGC110 (GGATCCGCCCAGGCCAGTTCGAGGC, corresponding to bases 912 to 930) for p29Δ25-139. Each of the forward primers contains a BamHI recognition site (indicated in boldface) preceding the CHV1-713 nucleotide sequence. The common reverse primer BR54 (GGATGCTGGTGATGGCC, complementary to bases 1386 to 1402) was used in all PCRs. The resulting PCR-amplified fragments were digested with BamHI and then used to substitute for the BamHI fragment of pLDST (bases 562 to 1219). Partial diagrams of the full-length wild-type CHV1-EP713 cDNA clone (pLDST) and the Δp29 mutant are shown for points of reference.

FIG. 2

ClampR analysis of dsRNAs recovered from C. parasitica transfectants. The regions covering the deletion sites were amplified from genomic dsRNA by ClampR (21) by using the primer set NS7 (CCGAACGAGGTCCGAACA, corresponding to bases 476 to 493) and NS8 (TTCAATCGGCCGCCAATC, complementary to bases 1233 to 1250). The migration positions of DNA size marker bands (lanes marked M) are indicated at the right.

FIG. 3

Colony morphology of C. parasitica strains transfected with recombinant CHV1-EP713 p29 deletion mutants. Colonies A through I were transfected with RNA transcripts derived from CHV1-EP713 cDNA clone pLDST (A), p29Δ25-52 (B), p29Δ25-63 (C), p29Δ25-73 (D), p29Δ25-85 (E), p29Δ25-97 (F), p29Δ25-109 (G), p29Δ25-139 (H), or Δp29 (I). Colony J is uninfected strain EP155. All colonies were cultured on 10-cm PDA plates on the benchtop for 6 days at 22 to 24°C.

FIG. 4

Colony morphology of C. parasitica strains transfected with p29 cysteine substitution mutant CHV1-EP713 RNAs. Colonies transfected with specific cysteine substitution mutant CHV1-EP713 RNAs are indicated by Cys(38), Cys(48), Cys(70), or Cys(72). Uninfected strain EP155 and transfectant Δp29 are included for reference. Colonies transfected with transcripts derived from CHV1-EP713 cDNA clone pLDST grown in parallel (not shown) were indistinguishable in morphology from colonies transfected with the Cys(38) and Cys(48) mutant transcripts.