Human ATP-binding cassette transporter 1 (ABC1): genomic organization and identification of the genetic defect in the original Tangier disease kindred

Abstract

Tangier disease is characterized by low serum high density lipoproteins and a biochemical defect in the cellular efflux of lipids to high density lipoproteins. ABC1, a member of the ATP-binding cassette family, recently has been identified as the defective gene in Tangier disease. We report here the organization of the human ABC1 gene and the identification of a mutation in the ABC1 gene from the original Tangier disease kindred. The organization of the human ABC1 gene is similar to that of the mouse ABC1 gene and other related ABC genes. The ABC1 gene contains 49 exons that range in size from 33 to 249 bp and is over 70 kb in length. Sequence analysis of the ABC1 gene revealed that the proband for Tangier disease was homozygous for a deletion of nucleotides 3283 and 3284 (TC) in exon 22. The deletion results in a frameshift mutation and a premature stop codon starting at nucleotide 3375. The product is predicted to encode a nonfunctional protein of 1,084 aa, which is approximately half the size of the full-length ABC1 protein. The loss of a Mnl1 restriction site, which results from the deletion, was used to establish the genotype of the rest of the kindred. In summary, we report on the genomic organization of the human ABC1 gene and identify a frameshift mutation in the ABC1 gene of the index case of Tangier disease. These results will be useful in the future characterization of the structure and function of the ABC1 gene and the analysis of additional ABC1 mutations in patients with Tangier disease.

Figure 1

Pedigree of Tangier disease kindred. Roman numerals indicate the number of the generation. Subjects in generations VI and VII are identified with arabic numbers. Solid symbols indicate homozygotes and half-filled symbols indicate obligate heterozygotes.

Figure 2

Lipid efflux study of kindred. (A) Lipid efflux from normal control fibroblast cells (open columns) and proband fibroblast (subject VII-1) (lined columns) was measured, using cholesterol-labeled cells (columns A-C) or phospholipid-labeled cells (column D), with either 100 μg/ml HDL (column A), 10 μg/ml apoA-I (columns B and D), or 10 μg/ml apoA-II (column C) as the acceptor. Results for control cells are the mean percent efflux ± SD from three normal cell lines. Results of the proband are the mean percent efflux ± SD of triplicate determinations. (B) Lipid efflux of kindred. Normal cells (column A), and cells from subjects VI-3 (column B), VII-1 (column C), and VII-2 (column D) were radiolabeled with cholesterol and incubated with 10 μg/ml apoA-I. Effux from control cells is the mean percent efflux ± SD from three normal cell lines. Results for the subjects from the kindred are the mean percent efflux ± SD of triplicate determinations.

Figure 3

DNA sequence analysis of ABC1 gene in proband. DNA sequences of control subject and proband (subject VII-1) are shown for part of exon 22 of the ABC1 gene. Arrow indicates the site of the TC deletion.

Figure 4

Diagram of the secondary structure of the ABC1 transporter. Arrow indicates the site of the TC deletion and the approximate location of the carboxyl terminus of the truncated protein. NBF indicates the positions of the nucleotide-binding folds.

Figure 5

Restriction digest polymorphism analysis of Tangier disease kindred. A 172-bp fragment was amplified from DNA extracted from peripheral blood leukocytes by PCR, using a sense primer starting at nucleotide 3181 (5′GGCCGCACCATTATTCTCTCT3′) and a reverse primer starting at nucleotide 3353 (5′GATTCCACATCCTTTCTTGACC3′). PCR fragments were digested with Mnl1 and analyzed on 3% Nusieve/0.5% Me Seakem gel. Letters above each lane correspond to the following samples: undigested control DNA (A), Mnl1-digested DNA from control (B), subject VII-1 (C), subject VII-2 (D), subject VI-3 (E), subject VI-2 (F), subject VI-6 (G), subject VI-4 (H), subject VI-5 (I), and subject VI-1 (J).