Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons used during construction

Abstract

A set of vectors which facilitates the sequential integration of new functions into the Escherichia coli chromosome by homologous recombination has been developed. These vectors are based on plasmids described by Posfai et al. (J. Bacteriol. 179:4426-4428, 1997) which contain conditional replicons (pSC101 or R6K), a choice of three selectable markers (ampicillin, chloramphenicol, or kanamycin), and a single FRT site. The modified vectors contain two FRT sites which bracket a modified multiple cloning region for DNA insertion. After integration, a helper plasmid expressing the flippase (FLP) recombinase allows precise in vivo excision of the replicon and the marker used for selection. Sites are also available for temporary insertion of additional functions which can be subsequently deleted with the replicon. Only the DNA inserted into the multiple cloning sites (passenger genes and homologous fragment for targeting) and a single FRT site (68 bp) remain in the chromosome after excision. The utility of these vectors was demonstrated by integrating Zymomonas mobilis genes encoding the ethanol pathway behind the native chromosomal adhE gene in strains of E. coli K-12 and E. coli B. With these vectors, a single antibiotic selection system can be used repeatedly for the successive improvement of E. coli strains with precise deletion of extraneous genes used during construction.

FIG. 1

Integration vectors and helper plasmids. Plasmids pLOI2223, pLOI2224, and pLOI2225 are integration vectors containing an R6K origin and can be replicated only in a host such as S17-1 which contains λpir. Plasmids pLOI2226, pLOI2227, and pLOI2228 contain a temperature-conditional pSC101 replicon which functions at 30°C but not at 37 to 42°C. Plasmid pLOI2403 contains a high copy replicon with an MCS site bracketed by AscI sites. DNA fragments can be assembled in the pLOI2403 MCS and moved to any integration vector by using AscI. Unique polylinker sites useful for the insertion of passenger DNA and homologous guide fragment are shown on the right side of each plasmid. Additional unique sites are also shown for the insertion of DNA which can be deleted at will after integration with the FLP recombinase. Plasmid pFT-A (ampicillin resistance) was constructed by Posfai et al. (26) and is used as a helper plasmid to express FLP recombinase. A similar plasmid expressing kanamycin resistance (pFT-K) was also constructed by Posfai et al. (26). Both contain a temperature-conditional pSC101 replicon. T7 and SP6 promoters can be used for sequencing. FRT recognition sites are illustrated as rectangles. Selectable markers and replicons are labeled. Complete sequences for pLOI2403 and the six integration vectors (pLOI2223 to pLOI2228) are available from GenBank under the following accession no.: AF172933, AF172934, AF172935, AF172936, AF172937, and AF172938, respectively. Ap, ampicillin; Km, kanamycin; Cm, chloramphenicol; Rep^ts, temperature conditional replication genes. Note that pLOI2403 contains two BsrFI sites.

FIG. 2

Use of double FRT integration vectors for the insertion of heterologous passenger genes into the chromosome. A guide fragment is ligated into the MCS of an integration vector to target homologous recombination with the chromosome. Since these vectors contain conditional replicons (pSC101 or R6K), integration into the chromosome can be directly selected by antibiotic resistance after transformation or electroporation. A helper plasmid is added to recombinants to express FLP recombinase under the control of the tetracycline promoter. Induction of FLP recombinase with autoclaved chlortetracycline results in precise deletion of DNA encoding the replicon and selectable marker flanked by FRT sites oriented in the same direction. A single FRT site, the passenger DNA, and the guide fragment remain in the chromosome. The helper plasmid with a temperature-conditional replicon can be readily eliminated from cells by growth at 37 to 42°C. Since genes used during construction are excised, the same selection procedure can be repeated in subsequent cycles to provide additional modifications or improvements of the same bacterium.

FIG. 3

Diagram illustrating the insertion of heterologous passenger genes into the chromosomal adhE gene (shaded) and FLP-mediated deletion of the replicon and marker used during construction. Plasmid pLOI2231 is a derivative of pLOI2224 with an AscI cassette containing adhE, pdc, adhB, and cat. Solid arrows above and below the sequences show the location of PCR primers. Promoters for adhE and cat are labeled with a P. No adhE, pdc, or adhB promoters were present in pLOI2231. Selected restriction sites are shown, which are referenced in the text. (A) Alignment of chromosomal adhE and the adhE coding region on pLOI2231. (B) Product of a single crossover event. (C) Product after FLP induction and FLP-mediated excision of the replicon and selectable marker. DNA segment marked by the dashed-line X represents the region excised by FLP recombinase. Arrows with numbers 1 to 6 represent the primers used to amplify the corresponding regions. Sequences for these primers are as follows: primer 1, 5′TTGCTCTTCCATGGCTGTTACTAATGTCGCTGAA3′; primer 2, 5′TTGCTCTTCGTTAAGCGGATTTTTTCGCTTTTTTCT3′; primer 3, 5′GTGAGTGTGAGCGCGGAGT3′; primer 4, 5′TGGCACGAGCATAACCTTC3′; primer 5, 5′CAGTACTGCGATGAGTGGCA3′; and primer 6, 5′GTTGCCAGACAGCGCTACT3′.

FIG. 4

PCR fragments containing the adhE gene and junctions. Amplification conditions for primer pairs 1 plus 2 and 3 plus 6 (25 cycles): 45 s at 94°C, 45 s at 60°C, and 60 s at 72°C. Amplification conditions for primer pairs 3 plus 4 and 5 plus 6 (30 cycles): 45 s at 94°C and 60 s at 60°C. DNA was held at 94°C for 3 min prior to the first cycle. Elongation time was increased to 10 min during the final cycle. (A) Full-length PCR products of adhE junctions. Positions and sequences of primers are provided in the legend for Fig. 3. Lane 1, HindIII digest of phage λ DNA (marker sizes, 23.1, 9.4, 6.6, 4.3, 2.3, and 2.0 kbp); lane 2, adhE coding region (2,696 bp) of SE2272 amplified with forward primer 1 and reverse primer 2; lane 3, adhE promoter and 3′ untranslated sequence (2,814 bp) of SE2272 amplified with forward primer 3 and reverse primer 4; lane 4, the adhE and pdc junction (3,108 bp) of FM18 amplified with forward primer 3 and reverse primer 4; lane 5, the cat junction and adhE (3,477 bp) of FM18 amplified with forward primer 5 and reverse primer 6. (B) BstEII digestion of PCR products. A single, central BstEII site was used to cleave PCR products containing adhE into N-terminal and C-terminal fragments. Lane 1 contains a DNA standard (descending, 3.0, 2.0, 1.5, 1.2, and 1.0 kbp). Lanes 2 through 5 contain BstEII-digested PCR products of fragments described for panel A, respectively. Fragment sizes are as follows (N-terminal plus C-terminal fragments): lane 2, 1,226 plus 1,470 bp; lane 3, 1,325 plus 1,489 bp; lane 4, 1,325 plus 1,783 bp; and lane 5, 1,988 plus 1,489 bp.