Functional conservation of the polysaccharide biosynthetic protein WbpM and its homologues in Pseudomonas aeruginosa and other medically significant bacteria

Abstract

WbpM is a highly conserved protein involved in synthesis of the O antigens of Pseudomonas aeruginosa. Homologues of this protein have been identified in a large number of bacteria, and they can be divided into two subfamilies: subfamily 1, including WbpM, contains large proteins ( approximately 600 amino acids), while subfamily 2, typified by HP0840 (FlaA1) of Helicobacter pylori, contains smaller proteins ( approximately 350 amino acids) homologous to the C termini of proteins in subfamily 1. Analysis of knockout mutants of wbpM in P. aeruginosa serotypes O3, O10, O15, and O17 showed that although all 20 serotypes of P. aeruginosa possess wbpM, it is not universally required for O-antigen biosynthesis. Homologous genes from Bordetella pertussis (wlbL), Staphylococcus aureus (cap8D), and H. pylori (flaA1) complemented a P. aeruginosa O5 wbpM mutant to various degrees. These conserved proteins may represent interesting targets for the design of inhibitors of bacterial exopolysaccharide biosynthesis.

FIG. 1

Complementation of a serotype O5 B-band-deficient mutant. Plasmids (see Table 2) containing wbpM or its homologues from S. aureus serotype 8 (capD), H. pylori 26695 (HP0840) and B. pertussis (wlbL) were used to complement a wbpM::Gm^r mutant of P. aeruginosa PAO1 (7). B-band LPS prepared by the proteinase K digestion method of Hitchcock and Brown (15) was separated on SDS-PAGE, transferred to nitrocellulose, and detected using monoclonal antibody 18-19, which recognizes the O5 O unit (18). The fastest-migrating band represents the core plus one O unit, the most abundant species.

FIG. 2

Analysis of wbpM::Gm^r mutants of selected P. aeruginosa serotype strains. (A) Correct insertion of the gentamicin resistance cassette within wbpM was ascertained by PCR using the wbpM-specific primers flanking the unique XhoI site (upstream primer, 5′ AGGGTGGCTATCTATGGCGCGGGG 3′; downstream primer, 5′ AACGGGTGATGCTCGGGTGGGTGA 3′). The mutants showed a shift in the size of the amplicon of approximately 1 kb, corresponding to the size of the Gm^r cassette. (B) LPS prepared from selected serotype strains, their wbpM::Gm^r mutants, and their complemented mutants was analyzed by silver-stained SDS-PAGE. Mutants lacking B-band O antigen were complemented with the serotype O5 wbpM gene on pFV163-26. It is not clear why the O17 wbpM mutant produces somewhat less B-band LPS than the wild-type strain, but the banding pattern is very similar and its O antigen is genuine O17 as determined by slide agglutination with O17-specific antiserum (data not shown).