Yin yang 1 negatively regulates the differentiation-specific E1 promoter of human papillomavirus type 6

Abstract

Human papillomavirus type 6 (HPV-6) is a low-risk HPV whose replication cycle, like that of all HPVs, is differentiation dependent. We have previously shown that CCAAT displacement protein (CDP) binds the differentiation-induced HPV-6 E1 promoter and negatively regulates its activity in undifferentiated cells (W. Ai, E. Toussaint, and A. Roman, J. Virol. 73:4220-4229, 1999). Using electrophoretic mobility shift assays (EMSAs), we now report that Yin Yang 1 (YY1), a multifunctional protein that can act as a transcriptional activator or repressor and that can also inhibit HPV replication in vitro, binds the HPV-6 E1 promoter. EMSAs, using subfragments of the promoter as competitors, showed that the YY1 binding site is located at the 5' end of the E1 promoter. When a putative YY1 site was mutated, the ability of YY1 to bind was greatly decreased. The activity of the mutated E1 promoter, monitored with the reporter gene luciferase, was threefold greater than that of the wild-type promoter, suggesting that YY1 negatively regulates HPV-6 E1 promoter activity. Nuclear extracts from differentiated keratinocytes showed decreased binding of YY1 to the wild-type promoter. Consistent with this, in differentiated keratinocytes, the activity of the transfected luciferase gene transcribed from the mutated promoter was comparable to that of the wild-type promoter; both promoters were up-regulated in differentiated keratinocytes compared to undifferentiated cells. These data suggest that YY1 functions in undifferentiated keratinocytes but not in differentiated keratinocytes. Both the wild-type and mutated promoters could be negatively regulated by overexpression of a plasmid encoding CDP. Thus, both YY1 and CDP appear to be negative regulators of the differentiation-induced HPV-6 E1 promoter and thereby the HPV life cycle. In contrast, only binding of CDP was detected using the E1 promoter of the high-risk HPV-31.

FIG. 1

Schematic illustration of HPV-6 E6, E7, and E1 promoters. The locations of CDP binding sites for HPV-6 are shown, as are the E6, E7, and E1 transcription initiation sites (arrows) and the oligonucleotides used in the EMSAs (gel shift assays) and the functional assays. The 5′ end of E1a, E1p, and E1R-1 is at the translation start site of E7 (nt 528). The 3′ end of E1a is at the AccI site (nt 616); the 3′ end of E1p is just upstream of the E1 transcriptional start site at the DraI site (nt 670). The E1R-1 sequence ends just upstream of the E1 translational start site (nt 829).

FIG. 2

The E1 promoter of HPV-31 binds CDP. (A) The sequence of the HPV-31 E1 promoter extending from the ATG of E7 at nt 560 through the E1 transcription initiation start site at nt 742 is shown (25). The 31E1p used in EMSAs extends from the 5′ end at nt 560 to the AccI site at nt 722. Putative CDP binding sites are double underlined; the AccI site is underlined with a dashed line. (B) EMSAs were conducted using radiolabeled HPV-31 E1p (31E1p, lanes 1 to 6) or HPV-6 E1a (6E1a, lanes 7 to 12) and either no competitor (−) or a 20- or 200-fold molar excess of unlabeled 31E1p (lanes 3, 4, 9, and 10) or 6E1a (lanes 5, 6, 11, and 12). (C) EMSAs were conducted using radiolabeled 31E1p and either antiserum to CDP (αCDP) or preimmune serum (PI). C1 and C2, retarded DNA-protein complexes; F, free probe.

FIG. 3

YY1 binds the HPV-6 E1 promoter. EMSAs were conducted using radiolabeled E1p (Fig. 1) and either no competitor (−) or a 20-, 50-, or 200-fold molar excess of unlabeled oligonucleotide containing a YY1 binding site (YY1), a mutated YY1 binding site (YY1^mut), or an AP-4 binding site (AP-4). In lane 12, antibody to YY1 (Ab) was included in the reaction mixture, and in lane 13, a control antibody (C) was included. The YY1 and YY1^mut oligonucleotides were purchased from Santa Cruz. Two complementary oligonucleotides were synthesized (Gibco/BRL) and subsequently annealed to produce the AP-4 competitor for use in EMSAs. The sequence of the top strand was 5′ GTGGTCAGCTGTAGGGCATCA 3′.

FIG. 4

The YY1 binding site is at the 5′ end of the E1 promoter. (A) Fragments used to dissect the E1 promoter for the YY1 binding site(s) are shown. The nucleotide coordinates of E1p and E1a are provided in the legend to Fig. 1. E1c extends from nt 528 to 585; E1d extends from nt 586 to 670. (B) EMSAs were conducted using radiolabeled E1p and unlabeled E1p subfragments as competitors. The C1 complex contains CDP, most of the binding activity of which is located in E1a (1).

FIG. 4

The YY1 binding site is at the 5′ end of the E1 promoter. (A) Fragments used to dissect the E1 promoter for the YY1 binding site(s) are shown. The nucleotide coordinates of E1p and E1a are provided in the legend to Fig. 1. E1c extends from nt 528 to 585; E1d extends from nt 586 to 670. (B) EMSAs were conducted using radiolabeled E1p and unlabeled E1p subfragments as competitors. The C1 complex contains CDP, most of the binding activity of which is located in E1a (1).

FIG. 5

Mutation of the YY1 binding site results in loss of YY1 binding. (A) The sequence of the HPV-6 E1 promoter extending from the ATG of E7 at nt 528 through the E1 transcriptional start site at nt 680 is provided. The YY1 binding site identified in this study is underlined; the mutations are shown above the wild-type sequence. Putative CDP binding sites on either strand are denoted by a double underline; restriction sites are indicated by a dashed underline. (B) The alignment of the HPV-6 E1p putative YY1 binding site with CCAT-containing YY1 binding sites in HPV-16 (48) and HPV-31 (34) is shown. Nt, the nucleotide position within the genome of the first nucleotide shown under Sequence; r, antisense orientation. (C) EMSAs were conducted using radiolabeled E1p (lanes 1 to 8) or E1p^mYY1 (lanes 9 to 16) and unlabeled competitor E1p (lanes 3 to 5 and 11 to 13) or E1p^mYY1 (lanes 6 to 8 and 14 to 16).

FIG. 6

YY1 represses the transcription from the E1 regulatory region. (A) Keratinocytes were transfected with either the wild-type (E1R-1) or the mutated (E1R-1^mYY1) regulatory region promoting expression of the reporter gene luc. Cells were grown in undifferentiated conditions (SFM) or differentiated conditions (DMEM plus fetal calf serum [FCS]) for 48 h, and cell lysates were subsequently assayed for luc activity. Activity was corrected for that of the cotransfected β-galactosidase-encoding control plasmid. Relative luc activity is plotted comparing all activities to that obtained with E1R-1luc in SFM, with the latter set to 1.0. (B) EMSAs were conducted using extracts obtained from cells grown in SFM (S, lanes 2 to 4 and 9 to 11) or in methylcellulose (M, lanes 5 to 7 and 12 to 14). +, anti-YY1; C, control antibody.

FIG. 7

CDP-mediated negative regulation of the E1 regulatory region is independent of the YY1 binding site. Keratinocytes were cotransfected with either an empty vector or the same vector overexpressing CDP and a plasmid containing either the wild-type or mutated E1R-1 regulatory region upstream of the luc gene. Cells were grown in undifferentiated conditions (SFM) for 48 h, and cell lysates were subsequently assayed for luc activity. For each regulatory region, the activity was corrected for that of the internal control and relative luc activity was plotted comparing the activity in the presence of CDP to that in the presence of empty vector, the latter activity being set to 1.0.

FIG. 8

Two negative regulators, YY1 and CDP, bind the HPV-6 E1 promoter. The binding sites for CDP were described previously (1). Data supporting the presence of a YY1 binding site are provided here.