The yeast TEL1 gene partially substitutes for human ATM in suppressing hyperrecombination, radiation-induced apoptosis and telomere shortening in A-T cells

Abstract

Homozygous mutations in the human ATM gene lead to a pleiotropic clinical phenotype of ataxia-telangiectasia (A-T) patients and correlating cellular deficiencies in cells derived from A-T donors. Saccharomyces cerevisiae tel1 mutants lacking Tel1p, which is the closest sequence homologue to the ATM protein, share some of the cellular defects with A-T. Through genetic complementation of A-T cells with the yeast TEL1 gene, we provide evidence that Tel1p can partially compensate for ATM in suppressing hyperrecombination, radiation-induced apoptosis, and telomere shortening. Complementation appears to be independent of p53 activation. The data provided suggest that TEL1 is a functional homologue of human ATM in yeast, and they help to elucidate different cellular and biochemical pathways in human cells regulated by the ATM protein.

Figure 1

(A) Cloning of mammalian TEL1 expression constructs. Genomic organization of the TEL1 locus and construction of plasmid pSP21 was described by Greenwell et al. (1995). TEL1rep contains the complete TEL1 gene (8361 bp) from S. cerevisiae cloned into the mammalian expression vector pRep5; deltaTELrep contains only the first 993 bp of TEL1. Both vectors include an unrelated genomic region upstream of the TEL1 gene encoding parts of the ribosomal protein L17a. The location of PCR primers FOR3 and REV3 is indicated by arrows at the 3′ end of TEL1rep. (B) Detection of TEL1-RNA in TEL1rep-transfected A-T cells. Total RNA was extracted from stably transfected cell populations, DNAseI digested and reverse transcribed. PCR primers FOR3 (CTATCGTTGGATACATATTAGGCC) and REV3 (CCATCCCATATATATAACACTC) specifically amplified a 544-bp fragment in RT-cDNAs from a pooled A-T population stably transfected with the TEL1rep expression plasmid (TEL1rep) and a derived subclone, TEL1rep(sr7). Control templates include RT-cDNA from populations transfected with the empty vector (pRep5) and truncated vector (deltaTElrep) as well as TEL1 DNA (TEL1rep) and yeast genomic DNA.

Figure 2

Reduced spontaneous conversion to lacZ⁺-positive A-T cells after transfection with the TEL1 expression vector. (A) Schematic depicting experimental procedure. (B) Colonies (%) that have been stably transfected with the TEL1 expression vectors indicated and that contain lacZ⁺ cells due to spontaneous recombination events within the pLrec recombination vector.

Figure 3

Reduced radiosensitivity of TEL1-transfected AT cells. Stably transfected A-T fibroblasts (GM5849) were analyzed for radiosensitivity in (A) clonogenic survival assays and (B) determination of apoptotic cells (%) after 3-Gy IR by fluorescence microscopy or (C) by FACS analysis. Designated populations are normal GM0639 (NL) cells or stably transfected A-T fibroblasts. AT, untransfected control AT cells; ATrep5, AT cells transfected with the empty expression vector pRep5; AT-deltaTEL, AT cells transfected with the truncated TEL1 expression construct; AT-deltaTELsr, single clone derived from the pool of cells stably transfected with deltaTELrep after streptonigrin exposure; AT-TEL1, pool of TEL1rep-transfected A-T cells; AT-TELsr7, single clone derived from the pool of cells stably transfected with TEL1rep after streptonigrin exposure. (A) Mean values and SDs from three (AT, ATrep5, and AT-deltaTEL) or eight (AT-TEL1, NL) experiments, each plated in duplicates. (B) Mean values and SDs from three (ATrep5), five (AT-TELsr7), or seven (AT-deltaTELsr, AT-TEL1, NL) double-blind experiments; in each experiment at least 500 cells per point were scored. (C) Representative experiment showing FACS-based analysis of apoptotic subG1 cells after staining with propidium iodide.

Figure 4

Analysis of TRF length in normal control cells (GM0847) and A-T (5L13) cells transfected with TEL1 expression vectors. Genomic DNA from cells was isolated, digested with AluI over night, separated on 0.8% agarose gels, blotted on nylon membranes, and hybridized to P³²-labeled high molecular telomeric probes. Following autoradiography, telomeric restriction fragments were detected. After scanning the films, the mean TRF length was determined as the peak intensity of the TRF signals and the size calculated after comparing the size standards. The mean TRF length was determined to be 2413 bp, 2617 bp, and 4177 bp, respectively, for 5L13, ATdeltaTEL, and AT-TEL1 cells, while the normal cell line GM0847 had substantially longer telomeres above 10 kB.

Figure 5

The expression of TEL1 has no effect on basic p53 protein levels and IR-induced p53 accumulation in A-T cells. Nuclear extracts were prepared following 10-Gy IR and p53 protein was detected in Western analyses (A). Normal GM637 cells showed a time-dependent p53 accumulation upon IR, while TEL1-transfected A-T cells failed to accumulate p53. This typical A-T deficiency also was confirmed in A-T control cells (not shown). (B) p53 protein was shifted with oligonucleotides containing the p53 consensus sequence from GADD45, again showing the clear accumulation of active, DNA-binding p53 protein upon IR in normal GM637 cells. Neither A-T cell line showed an accumulation of DNA-bound p53 upon IR. Supershift analyses using anti-p53 antibody pAb421 confirmed the specificity of the shifted p53 bands (C).