The 17 nucleotides downstream from the env gene stop codon are important for murine leukemia virus packaging

Abstract

We have identified a previously unknown nucleotide sequence important for the packaging of murine leukemia virus. This nucleotide sequence is located downstream from the stop codon of the env gene but does not overlap the polypurine tract. Deletion of 17 bp from this region resulted in a more than 10-fold decrease in viral titer. Consistent with this result, the deletion mutant showed a 20- to 30-fold drop in the amount of virion RNA in the culture supernatant. The total amount of virion protein in the culture supernatant was comparable for the deletion mutant and the parental virus, suggesting that the mutant construct could release the empty viral particles. These results suggested that the packaging signal sequence might be present at the two extreme sites of the viral genome, one in the region around the splice donor sequence downstream from the 5' long terminal repeat (LTR) and the other immediately upstream from the 3' LTR. Implications for gene therapy, especially in regard to construction of retroviral vectors and packaging constructs, are discussed.

FIG. 1

Schematic representation of retroviral vectors used in this study. MSN contains the nucleotide sequence from the 5′ end of the 5′ LTR to the region right before the start codon of the gag gene. At the 3′ side, MSN has all the nucleotide sequences downstream from the stop codon of the env gene. MSNΔ17 is identical except that it lacks the 17-nucleotide sequence immediately downstream from the stop codon of the env gene. The bacterial CAT sequence was used as a reporter gene and the selectable marker neo is driven by the internal SV40 early promoter. Plasmids used in this study were constructed by PCR using proofreading Pfu DNA polymerase (Stratagene, La Jolla, Calif.). The nucleotide sequences of final constructs were always determined to confirm that there were no mutations introduced by this amplification step. The retroviral vector MSN, which does not have any viral coding sequences, was constructed as follows. pMLV (22) was used for the amplification of the 5′ and 3′ LTR regions. The nucleotide sequences of primers used in amplifying the 5′ LTR region of MLV are as follows (the restriction linkers attached to each primer are underlined): (i) HHIR, AAGCTTATGTGAAAGACCCCTCCTG (the HindIII region is underlined), and (ii) 5LTR3, GGATCCGCGGGCCCACGCGTATTTTCAGACAAATACAGAAAC (the BamHI, SacII, ApaI, and MluI regions are underlined). The amplified product covered the 5′ LTR and 5′ noncoding regions containing packaging signals of MLV. The amplified HindIII-BamHI fragment was cloned into pUC 18, generating p5LTR. To amplify the 3′ LTR region, PCR was performed using primers 3LTR5 and 3LTR3 (3LTR5, GGATCCTCGAGGATAAAATAAAAGATTTTATTTAGTCTCC [the BamHI and XhoI regions are underlined], and 3LTR3, GAATTCAATGAAAGACCCCCGCTGAC [the EcoRI region is underlined]). The amplified product covered the entire 3′ untranslated region downstream from the stop codon of env, containing the polypurine tract and 3′ LTR. The amplified BamHI-EcoRI fragment was then cloned into p5LTR, resulting in pM, retroviral backbone. To insert the SV/Neo cassette into pM, the BamHI-XhoI fragment from pDON-AI (Takara, Shiga, Japan) was inserted into the BamHI-XhoI site of pM, resulting in MSN. To construct MSNΔ17, the 3′ LTR region was amplified using primers M3L52 and 3LTR3 (M3L52, AAAGGATCCATTTAGTCTCC [the BamHI region is underlined], and 3LTR3, GAATTCAATGAAAGACCCCCGCTGAC [the EcoRI region is underlined]). The amplified product covered a 3′ untranslated region 17 bp downstream from the stop codon of env, containing the polypurine tract and 3′ LTR. The amplified BamHI-EcoRI fragment was then cloned in p5LTR, resulting in pMΔ17, retroviral backbone. The BamHI-XhoI fragment from pDON-AI was then inserted into the BamHI-XhoI site of pMΔ17, resulting in MSNΔ17. To construct the retroviral vectors expressing CAT, the BamHI CAT fragment from PCRII-CAT (9) was inserted into the BamHI site of each vector.

FIG. 2

RNA blot analysis of 293T cells transfected with MSN-CAT or MSNΔ17-CAT retroviral constructs. Total RNA (20 μg) was subjected to 1% formaldehyde-agarose gel electrophoresis, blotted to nitrocellulose membrane (Hybond-C; Amersham Pharmacia, Piscataway, N.J.), and hybridized with a ³²P-labeled CAT probe. A, cellular actin RNA.

FIG. 3

Test for preservation of retroviral sequences in transduced cells. Total cellular DNAs were prepared from G418-resistant PG13 cells transduced with retroviral vectors as described by Kim et al. (11). PCR was performed with 5 μg of total genomic DNA and oligonucleotide primers specific to various regions of the retroviral vector as indicated. The two pairs of oligonucleotide primers used to amplify the retroviral regions were described in the Fig. 1 legend.

FIG. 4

Quantitative analysis of virion RNA by real-time quantitative RT-PCR. (A) Amplification curves of virion RNAs (left) or control cellular RNAs (right). Virion RNAs of MSN-CAT or MSNΔ17-CAT were purified and mixed with equal amounts of total cellular RNA from PG13 cell lines. cDNAs were then synthesized by reverse transcription followed by PCR analysis using specific primers for CAT (viral RNA as it is present in the viral genome) or GaLV env genes (control “cellular” RNA as it is present in the cell as an integrated form), respectively. At each PCR reaction, the C_T value was obtained from the amplification curve. The relative copy numbers of starting RNA were calculated as previously described (16) and are indicated as n. NTC, control containing no template. (B) Amplification curves of viral RNAs of retroviral vectors (left) inside PG13 cells or cellular GaLV env gene RNA (right) of PG13 cells are also shown. Total cellular RNAs of PG13 cells containing MSN-CAT or MSNΔ17-CAT proviruses were purified. cDNAs were then synthesized by reverse transcription followed by PCR analysis using specific primers for the CAT (left) or GaLV env genes (right). The result shown here is one representative of three independent assays.

FIG. 5

Analysis of viral protein p30^gag by Western blotting. Producer cells were plated at 5 × 10⁶ cells per 100-mm dish, and 2 days later viruses were harvested and filtered through a 0.45-μm-pore-size filter. The same amount of filtered supernatants was concentrated by centrifugation at 25,000 rpm for 90 min in an SW41 roter. Viral pellets were suspended in a Laemmli buffer (13). An equal amount of viral protein lysates was subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and probed with antisera specific for p30^gag of MLV. The result shown here is one representative of more than three independent assays using different dilutions of the sample.