Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing

Abstract

Neuroendocrine ACTH secretion responds to peripheral inflammatory and stress signals. We previously demonstrated that the proinflammatory cytokine, leukemia inhibitory factor (LIF), affects the hypothalamo-pituitary-adrenal axis (HPA) by stimulating in vitro and in vivo pituitary proopiomelanocortin (POMC) gene expression and ACTH secretion and by potentiating the action of hypothalamic corticotropin releasing hormone (CRH). Whereas pathways shown thus far to regulate POMC expression exclusively involve cAMP or calcium, we here describe a direct and indirect STAT3-dependent regulation of POMC transcription by LIF. Using progressive 5'-deletions of POMC promoter, we identified a LIF-responsive -407/-301 region that contains two juxtaposed sequences within -399/-379 related to a STAT3 DNA-binding motif. Each sequence within -399/-379 separately corresponds to a low-affinity and direct binding site for STAT3, but, in combination, these sequences bind STAT3 cooperatively and with high affinity. Moreover, LIF-activated STAT3 indirectly mediates LIF corticotroph action by inducing and potentiating CRH-induced c-fos and JunB expression and binding to the POMC AP-1 element. We therefore conclude that both a direct and indirect route mediate LIF-induced STAT3 activation of POMC transcription. Demonstration of STAT3-dependent regulation of the POMC gene represents a powerful mechanism for immuno-neuroendocrine interfacing and implies a direct stimulation of ACTH secretion by inflammatory and stress-derived STAT3-inducing cytokines.

Figure 1

Identification of a LIF-responsive region on the POMC promoter. Progressive 5′ deletions of the POMC promoter were fused to the luciferase reporter gene and transiently transfected in AtT20 cells (9). Cells were stimulated with 1 nM LIF (a) or with 1 nM LIF + 10 nM CRH (b) for 6 hours. Luciferase activity was measured in cell lysates in the presence of the luciferin substrate. Results are expressed as percentage of control (n ≥ 3; control = 100% = full-length –706/+64 POMC promoter). ^AP < 0.05 and ^BP < 0.01 for deleted POMC promoter constructs (constructs B–G) versus full-length POMC promoter (construct A).

Figure 2

Characterization of a STAT3 binding site on the POMC promoter. (a and b) A ³²P-labeled double-stranded oligonucleotide corresponding to region –407/–374 of the POMC promoter (5′- ^–407TAGTGATATTTACCTCCAAATGCCAGGAAGGCA G^–374 -3′; in bold are the two STAT3 DNA-binding motifs) was used as probe. Cells were either untreated or treated with 1 nM LIF for 15 or 30 minutes. Using 15 μg nuclear extracts from 15-minute LIF-treated AtT20 cells, competition was performed with either 100-fold molar excess of (a) cold –407/–374 double-stranded oligonucleotide (self), of cold nonspecific POMC exon-1 AP-1 double-stranded oligonucleotide (AP-1) (5′- ⁺³³AGGAGCAGTGACTAAGAGAGGC⁺⁵⁴ -3′; in bold is the consensus AP-1 motif), of (b) cold SIE oligonucleotide (5′- CGCGTCATTTCCCGTAAATCA -3′; in bold is the consensus SIE motif) (SIE), of cold mutated SIE oligonucleotide (5′- CGCGTCAGATCCCGTCATTCA -3′; the bold underlined italic letters correspond to the mutated bases from the SIE motif) (SIE mut), or with 1 μg anti-STAT3 (STAT3 Ab) or c-fos antibody (c-fos Ab). (c) POMC promoter deleted from –459/–355 (construct H) or mutated in the –399/–379 region (construct I) (5′- ^–399GTGACATCCAGAGGCTAGTG^–379 -3′; the bold underlined italic letters correspond to the mutated bases from the POMCSTAT3 motifs) were fused to the luciferase reporter gene and transiently transfected in AtT20 cells (9). Cells were stimulated with 1 nM LIF or with 1 nM LIF + 10 nM CRH for 6 hours. Luciferase activity was measured in cell lysates in the presence of the luciferin substrate. Results are expressed as percentage of control (n ≥ 3; control = 100% = full-length –706/+64 POMC promoter). ^AP < 0.01 for deleted or mutated POMC promoter constructs (constructs H and I) versus full-length POMC promoter (black bar).

Figure 3

Characterization of two cooperative low-affinity STAT3 binding sites on the POMC promoter. (a) This experiment was performed as in Figure 2a, except that competition was performed with 100-fold molar excess of cold mut1 (5′- ^–407 TAGTGATAGTGACATCCAGATGCCAGGAAGGCAG^–374 -3′), mut2 (5′- ^–407TAGTGATATTTACCTCCAAAGGCTAGTGAGGCAG^–374 -3′), mut1-2 (5′- ^–407TAGTGATAGTGACATCCAGAGGCTAGTGAGGCAG^–374 -3′), or nonspecific POMC exon-1 AP-1 oligonucleotide. (b and c) Competition was performed as in a with 25-fold, 50-fold, or 75-fold molar excess of wild-type –407/–374 (self) or mut1 or mut2 cold double-stranded oligonucleotide. NT, vehicle-treated control.

Figure 4

Inhibition of LIF-induced STAT3 in SOCS-3 overexpressing AtT20 cells disrupts STAT3 binding to the POMC –407/–374 probe. (a) EMSA was performed as in Figure 2a with 15 μg nuclear extracts derived from LIF-treated mock- or SOCS-3–overexpressing cells for 15 or 30 minutes. A 100-fold molar excess of cold POMC –407/–374 double-stranded oligonucleotide (self) or 1 μg anti-STAT3 antibody (STAT3 Ab) was used as competitor. (b) To show that STAT3 concentration was identical in both mock- and SOCS-3–overexpressing cells and at each reaction time point, LIF-treated whole cell extracts were prepared from the same cell aliquot as the one used for preparation of nuclear extracts and used for Western blotting with an anti-STAT3 antibody.

Figure 5

LIF and CRH are additive for c-fos and JunB mRNA expression. (a) A total of 10 μg total RNA extracted from 1 nM LIF–, 10 nM CRH–, or LIF+CRH–treated AtT20 cells for 30 minutes or 1 hour were separated on a 1% agarose/formaldehyde gel and transferred to nitrocellulose membrane. Hybridization was performed with a ³²P-labeled double-stranded DNA probe corresponding to the c-fos, JunB, c-Jun, JunD, Nurr1, Nur77, or β-actin coding sequence, as described previously (23). (b) Northern blot signals for c-fos and JunB mRNA were analyzed by quantitative densitometry and normalized for β-actin. The relative increase of LIF–, CRH–, and LIF+CRH–induced c-fos and JunB mRNA was calculated from three independent experiments (n = 3). NT, vehicle-treated control.

Figure 6

LIF and CRH have additive effects on c-fos and JunB binding to the POMC exon-1 AP-1 element. (a) A ³²P-labeled double-stranded oligonucleotide corresponding to region +33/+54 AP-1 of POMC promoter (5′- ⁺³³AGGAGCAGTGACTAAGAGAGGC⁺⁵⁴ -3′) was used as probe. Cells were either untreated or treated for 1 hour with 1 nM LIF and/or 10 nM CRH. By using 15 μg nuclear extracts from 1-hour LIF+CRH–treated AtT20 cells, competition was performed with either 100-fold molar excess of cold +33/+54 AP-1 double-stranded oligonucleotide (self), mutated AP-1 double-stranded oligonucleotide (mut) (5′- ⁺³³AGGAGCAGCGTACGAGAGAGGC⁺⁵⁴ -3′), with 1 μg anti–c-fos antibody (c-fos Ab), with 1 μg anti-JunB antibody (JunB Ab), or with 1 μg anti–c-fos and 1 μg anti-JunB antibody (c-fos+JunB Ab). (b) POMC promoter deleted from +34/+53 (construct J) or mutated in the +41/+47 region (construct K) (5′- ⁺⁴¹CGTACGA⁺⁴⁷ -3′) were fused to the luciferase reporter gene and transiently transfected in AtT20 cells (9). Cells were stimulated with 1 nM LIF or with 1 nM LIF + 10 nM CRH for 6 hours. Luciferase activity was measured in cell lysates in the presence of the luciferin substrate. Results are expressed as percentage of control (n ≥ 3; control = 100% = full-length –706/+64 POMC promoter). ^AP < 0.01 for deleted or mutated POMC promoter constructs (constructs J and K) versus full-length POMC promoter (black bar). NT, vehicle-treated control.

Figure 7

Blockade of LIF-induced STAT3 in SOCS-3–overexpressing AtT20 cells abrogates LIF stimulation of c-fos and JunB transcription. A total of 10 μg total RNA extracted from 1 nM LIF–, 10 nM CRH–, or LIF+CRH–treated mock or SOCS-3–transfected AtT20 cells for 30 minutes or 1 hour were separated on a 1% agarose/formaldehyde gel and transferred to nitrocellulose membrane. Hybridization was performed with a ³²P-labeled double-stranded DNA probe corresponding to the c-fos, JunB, or β-actin coding sequence, as described previously (23). NT, vehicle-treated control.

Figure 8

Model for LIF and CRH synergistic induction of POMC promoter activity. The molecular basis for LIF and CRH synergy on the POMC promoter is defined as an integration of both independent and cooperative effects of both peptides on corticotroph function: First, LIF directly induces STAT3 binding to the POMC promoter on the –399/–379 region. Second, CRH induces CREB binding on the exon-1 AP-1 site (+41/+47), and Nurr binding to the glucocorticoid receptor responsive element (–70/–63) or to the –404/–383 element. Third, two common elements on the POMC promoter mediate LIF and CRH synergy: the exon-1 AP-1 site, which additively binds both LIF and CRH-induced c-fos and JunB, and the –173/–160 element, which corresponds to a metallothionein responsive element and binds PCRH-REB-1.