Targeted disruption of the Kvlqt1 gene causes deafness and gastric hyperplasia in mice

Abstract

The KvLQT1 gene encodes a voltage-gated potassium channel. Mutations in KvLQT1 underlie the dominantly transmitted Ward-Romano long QT syndrome, which causes cardiac arrhythmia, and the recessively transmitted Jervell and Lange-Nielsen syndrome, which causes both cardiac arrhythmia and congenital deafness. KvLQT1 is also disrupted by balanced germline chromosomal rearrangements in patients with Beckwith-Wiedemann syndrome (BWS), which causes prenatal overgrowth and cancer. Because of the diverse human disorders and organ systems affected by this gene, we developed an animal model by inactivating the murine Kvlqt1. No electrocardiographic abnormalities were observed. However, homozygous mice exhibited complete deafness, as well as circular movement and repetitive falling, suggesting imbalance. Histochemical study revealed severe anatomic disruption of the cochlear and vestibular end organs, suggesting that Kvlqt1 is essential for normal development of the inner ear. Surprisingly, homozygous mice also displayed threefold enlargement by weight of the stomach resulting from mucous neck cell hyperplasia. Finally, there were no features of BWS, suggesting that Kvlqt1 is not responsible for BWS.

Figure 1

Mutational inactivation of the mouse Kvlqt1 gene. (a) Mouse Kvlqt1 genomic locus and knockout construct. Top: restriction map of exons 1 and 2; middle: 6-kb EcoRV-EcoRI fragment subcloned into pBluescript. The open box denotes the insertion of the neo gene in exon 1. The neo cassette was inserted after A₃₄₅ as marked by the arrow in the following sequence: CCACTATTGA↓GCAGTATGCC. The nucleotide sequences are based on U70068. The KvLQT1 is translated from the nucleotide 104. The exon 1 is shared by all isoforms, so targeting at exon 1 inactivates all KvLQT1 isoforms. The detailed description of isoforms and their organization can be found in ref. . The dashed lines mark the targeted region for homologous recombination. Bottom: restriction map of the Kvlqt1 locus after recombination. A diagnostic Pvu II site generates a mutant-specific 3.9-kb fragment using the probe indicated, in contrast to a 4.2-kb Pvu II fragment in the wild-type mouse locus. (b) Genotyping of transgenic mice. Genomic DNA was digested with Pvu II and hybridized with the probe shown in a. The +/+ indicates wild-type as demonstrated by a single 4.2-kb Pvu II fragment, +/– indicates heterozygous mice as demonstrated by the presence of both 4.2- and 3.9-kb fragments, and –/– indicates homozygous mutant as demonstrated by a single 3.9-kb mutant Pvu II fragment. This is also consistent with typing by PCR (data not shown) and phenotype. (c) Presence or absence of KvLQT1 expression in wild-type and mutant mice, as measured by RT-PCR using primers spanning an intron-exon boundary. The forward primer, mLQT111 (GTGTTTCGTGTACCACTTCACCGTCTT), in exon 1a and exon 1 (across the junction) is upstream to the neo insertion site, and reverse primer, mLQT211 (TACCATTGGCTACGGGGATAAGGTACC) in exon 6 is downstream to the neo insertion site. The presence of a 1.6-kb insertion in homozygous mutant mice prevents the efficient amplification in RT-PCR reaction.

Figure 2

ABR of Kvlqt1 knockout mice. Representative ABR hearing threshold measurements from the left ears of wild-type (a) and homozygous knockout (b) mice. The numbers to the right of each tracing represent decibels (dB) in sound pressure level (SPL) delivered to the ear. Representative ABR waveforms enabling the determination of threshold are marked in brackets. In all animals, thresholds were the same for both ears within a given mouse. Stimulus artifact generated at high decibels (>90 dB) is noted by an S.

Figure 3

Cochlear histopathology of Kvlqt1 knockout mouse. (a) Normal histology of unaffected heterozygous mouse for comparison. (b and c) Base (b) and apex (c) of affected homozygous knockout mouse, showing complete loss of hair cells and supporting cells from the organ of Corti, which is replaced by fibrosis between the tectorial membrane and the basilar membrane (open arrow). The cell density in the spiral ganglion (SG) is decreased in the base but normal in the apex. There is marked degeneration of the stria vascularis (SV) throughout the cochlea, with more dramatic loss seen in the basal and middle half-turns. Reissner’s membrane is adherent to the spiral ligament and the tectorial membrane in the basal regions of the cochlea, resulting in the obliteration of the scala media (filled arrow in b). The reduction of the scala media volume is more severe in the base than in the apex. IHC, inner hair cells; OHC, outer hair cells; RM, Reissner’s membrane; TM, tectorial membrane; TC, tunnel of Corti.

Figure 4

Vestibular histopathology of Kvlqt1 knockout mouse. (a) Normal histology of the utricle of unaffected heterozygous mouse for comparison. (b) Affected homozygous knockout mouse, showing marked reduction in the size of the endolymphatic compartment, associated with adhesions between the membranous envelope, the inner surface of the otic capsule and the otolithic membrane. The otolithic membrane shows irregular borders and is separated from the neuroepithelium (filled arrows). There is also a loculated collection of granular material (open arrows) in close association with the otolithic membrane. There is a marked reduction in hair cell number (identified by the presence of a white halo around the nucleus) in the neuroepithelium of the utricle in the homozygous mutant mouse (asterisk). These cells are particularly prominent in the center of the neuroepithelium in the heterozygous mutant mouse in which type I cells with large chalice-like nerve endings predominate.

Figure 5

Gastric pathology in Kvlqt1 knockout mice. Compared with paraffin sections of wild-type fundic mucosa (a), Kvlqt1 knockout mouse fundic mucosa (b) showed increased epithelial cell proliferation as measured by Ki67 indirect immunoperoxidase. In both cases, however, the proliferative zone was properly placed in the isthmic region of the glands. This zone was expanded in the knockout mouse, and the overall mucosal thickness was increased owing to increased numbers of epithelial cells in the deeper compartments. PAS staining in gastric fundus of wild-type mice (c) and homozygous mutant mice (d) was largely confined to the apical portions of normal foveolar epithelial cells. In mutant mice, a broad zone of less intensely staining cells was present in the midportion of the mucosa, and the PAS staining of surface mucous cells was reduced (d). Hematoxylin and eosin staining of cells in the neck region of the mutant mice (e) showed dilated glands with many mucinous cells and vacuolated parietal cells. Immunostaining for H/K-ATPase (f) demonstrated staining in the cytoplasm of these parietal cells without staining of the intracellular vacuoles. Immunostaining of mucous neck cells for spasmolytic polypeptide in wild-type mice (g) showed staining of a small number of cells in the isthmic region. Prominent spasmolytic polypeptide staining was observed in knockout mouse hyperplastic mucous cells (h) along the entire length of the gland. Immunostaining for intrinsic factor in wild-type (i) and knockout (j) mice showed decreased numbers of chief cells in mutant mice. Bar, 40 μm (a, b, i, and j), 20 μm (c and d), 10 μm (e and f), and 60 μm (g and h).