Multiplex allele-specific target amplification based on PCR suppression

Abstract

We have developed a strategy for multiplex PCR based on PCR suppression. PCR suppression allows DNA target amplification with only one sequence-specific primer per target and a second primer that is common for all targets. Therefore, an n-plex PCR would require only n + 1 primers. We have demonstrated uniform, efficient amplification of targeted sequences in 14-plex PCR. The high specificity of suppression PCR also provides multiplexed amplification with allele specificity. Multiplexed PCR was used to develop assays for genotyping DNA samples from cystic fibrosis-affected individuals. The new approach greatly simplifies primer design, significantly increases the PCR multiplexing level, and decreases the overall primer cost. In addition, this assay is more readily amenable to automation and is therefore suitable for high-throughput genetic diagnostics.

Figure 1

Outline of the PS PCR procedure.

Figure 2

PS-based mpxPCR targeted at several anonymous sequences in chromosome 7 DNA. 5 ng of RsaI-digested human genomic DNA with ligated adapter was amplified in a 25 μl reaction containing 1 × PCR buffer (PE), 2.5 mM MgCl₂, 250 μM dNTP, 2.5 units of thermostable DNA polymerase [a (1:1:1) mixture of Taq, AmpliTaq, and AmpliTaq Gold DNA polymerases] and 5 pmol of each primer. The fluorescently labeled A primer was TGTAGCGTGAAGACGACAGAA, which corresponded to the 5′ outermost part of the ligated adapter. For the T primers see Table 1. (A) RsaI restriction maps of two fragments from human chromosome 7 with the PCR primers. (B) Resolution of mpxPCR products by using 2% agarose gel electrophoresis. (1) PCR with the T primers 1 + 2; (2) PCR with the T primers 3 + 4; (3) PCR with the T primers 1 + 2 + 3 + 4 (see Table 1); (M) 100-bp size marker. (C) Resolution of the 4-plex (Top; primers 1–4 in Table 1) and 5-plex (Bottom; primers 1–5 in Table 1) PCR products by using 6% PAGE and an ALF sequencer. The numbers above the peaks show the amplicon lengths. The 1-kb-long PCR amplicon is beyond the displayed window.

Figure 3

14-fold mpxPCR. (a) A 5-plex PCR was performed with primers 1–5 (Table 1); (b) 4-plex PCR with primers 2, 3, 5, and 8 (Table 2); (c) 5-plex PCR with primers 1, 4, 6, 7, and 9 (Table 2): (d) 14-plex PCR with primers 1–5 (Table 1) plus primers 1–9 (Table 2). Primers 2, 3, and 5 (Table 2) were normal types. Other conditions were as in Fig. 2. The 450-bp fragment (aldolase B gene; primer 4 in Table 2) appeared as a double peak, as it also did in a uniplex PCR (data not shown). The 1-kb-long fragment (product generated by the primer 5 in Table 1) is beyond the displayed window. The fragment's lengths (bp) are indicated above the peaks. The 200-bp-long IL2 amplicon is marked by an arrow.

Figure 4

Different DNA polymerases display different specificity in mpxPCR. 4-plex PCR used primers 1, 2, 3, and 4 in Table 1. Thermostable DNA polymerase (2.5 units) or a mixture of two DNA polymerases (2.5 units) was used in PCR. Other conditions were as in Fig. 2. PD, primer-dimers.

Figure 5

Allele-specific mpxPCR. (A) Uniplex reactions with normal (N) and mutated (M) primers targeting the interleukin-2 gene (IL2), neurofibromatosis (NFM) gene, and α₂-macroglobulin (MG) gene. (B) A 4-plex PCR with an equimolar mixture of normal type (N) or mutant (M) primers. The fourth target in both reactions was a fragment of the integrin B₂ subunit gene (primer 8 in Table 2). The PCR products were resolved on a 2% agarose gel. (C) A window showing the absence of two targets (MG and IL2, marked by arrows) amplified with the mutant primers in a 14-plex PCR. PCR products were resolved by using 6% PAGE in an ALF sequencing instrument.

Figure 6

Genotyping of CF human DNA samples. (A) Uniplex reactions with primers targeting normal type (1), ΔF508 CFTR-homozygous (2), and ΔF508 CFTR-heterozygous (3) DNA. The PCR products were analyzed on a 2% agarose gel. (B) Genotyping of the same DNA samples in a 4-plex PCR. In this reaction, CFTR normal type (N) and CFTR mutant (M) primers (primers 10 and 11, respectively, in Table 2) were used in a mixture with primers 1, 2, and 4 (Table 1) (see Materials and Methods for the details).