Ku80 is required for addition of N nucleotides to V(D)J recombination junctions by terminal deoxynucleotidyl transferase

Abstract

V(D)J recombination generates a remarkably diverse repertoire of antigen receptors through the rearrangement of germline DNA. Terminal deoxynucleotidyl transferase (TdT), a polymerase that adds random nucleotides (N regions) to recombination junctions, is a key enzyme contributing to this diversity. The current model is that TdT adds N regions during V(D)J recombination by random collision with the DNA ends, without a dependence on other cellular factors. We previously demonstrated, however, that V(D)J junctions from Ku80-deficient mice unexpectedly lack N regions, although the mechanism responsible for this effect remains undefined in the mouse system. One possibility is that junctions are formed in these mice during a stage in development when TdT is not expressed. Alternatively, Ku80 may be required for the expression, nuclear localization or enzymatic activity of TdT. Here we show that V(D)J junctions isolated from Ku80-deficient fibroblasts are devoid of N regions, as were junctions in Ku80-deficient mice. In these cells TdT protein is abundant at the time of recombination, localizes properly to the nucleus and is enzymatically active. Based on these data, we propose that TdT does not add to recombination junctions through random collision but is actively recruited to the V(D)J recombinase complex by Ku80.

Figure 1

Expression of TdT. (A) Cells were transfected with expression vectors encoding TdT (1.5 µg), RAG-1 (1.8 µg) and RAG-2 (2.1 µg). Cells were harvested at the time points indicated. Total cell lysate was analyzed on duplicate gels which were transferred to membranes and probed with monoclonal anti-TdT (upper) or anti-myc antibodies (which detect the myc tag on the expressed RAG proteins) (lower). (B) Cells were transfected with different amounts of TdT expression vector, as indicated, and collected at 48 h. Protein was isolated from the Hirt preparation.

Figure 2

Analysis of signal joints. (A) Nucleotide sequence analysis of signal joints. Letters in the center indicate extra nucleotides. The amount of TdT transfected is shown. The number of nucleotides deleted from each end is shown under del. The number of junctions with the indicated sequences is shown under n. The data for xrs-6 cells were collected from two independent transfections at each TdT concentration. Imperfect and additional imperfect describe junctions that were ApaL1-resistant but were not sequenced. 2H, 3H and 6H indicate 2, 3 or 6 nt of homology, respectively, at the junction. (B) Summary of frequency of N regions. Because signal joints from wild-type cells very rarely contain deletions (see text), ApaL1-resistant junctions were plotted as junctions containing N regions. All signal joints recovered from xrs-6 cells were sequenced. *The sequences of the long inserts are as follows: 22 nt, ACAGCCAGACAGTGGAGTACTA; 28 nt, ACAGTGTACAGTGTACAGTGGAGTACTA. The underlined sequence is from plasmid pJH289. The sequence in italics is a triplet of the sequence ACAGTGT, which occurs in the RAG-1 and RAG-2 expression vectors, pMS127 and pMS216E.

Figure 3

Analysis of hybrid joints. (A) Frequency of junctions containing N regions [sequences are shown in (B)]. Data for RMP41 cells at 0 µg TdT were reported previously (69), but were generated in parallel with experiments using TdT. Data for CHOK1 and xrs-6 cells at 0 µg TdT have been reported previously (50). (B) Nucleotide sequence analysis of hybrid joints (details are as in Fig. 2A legend). Circled letters are presumptive P nucleotides. *The sequence of this insert (24 nt) is TTTCACACCGCATATGGTGCCGAC. The underlined sequence is from the recombination substrate pJH299.

Figure 4

Detection of TdT in cells. TdT was detected by rabbit anti-TdT antibodies (green fluorescence). Nuclei are stained with Hoechst 33258 (blue fluorescence). (A) Wild-type RMP41 cells; (B) xrs-6 cells. Original magnification 400×.

Figure 5

Primer extension assay for TdT activity in extracts. A ³²P-labeled 20mer (open arrow) was incubated with extract from CHOK1 (lanes 1–4) or xrs-6 (lanes 5–8) cells either transfected (+TdT) or not transfected (–TdT) with TdT expression vector. Reactions were stopped at the time points indicated. Arrows at the right indicate predominant TdT-dependent extension products. All lanes are from the same gel.