Analysis of promoter recognition in vivo directed by sigma(F) of Bacillus subtilis by using random-sequence oligonucleotides

Abstract

Formation of spores from vegetative bacteria by Bacillus subtilis is a primitive system of cell differentiation. Critical to spore formation is the action of a series of sporulation-specific RNA polymerase sigma factors. Of these, sigma(F) is the first to become active. Few genes have been identified that are transcribed by RNA polymerase containing sigma(F) (E-sigma(F)), and only two genes of known function are exclusively under the control of E-sigma(F), spoIIR and spoIIQ. In order to investigate the features of promoters that are recognized by E-sigma(F), we studied the effects of randomizing sequences for the -10 and -35 regions of the promoter for spoIIQ. The randomized promoter regions were cloned in front of a promoterless copy of lacZ in a vector designed for insertion by double crossover of single copies of the promoter-lacZ fusions into the amyE region of the B. subtilis chromosome. This system made it possible to test for transcription of lacZ by E-sigma(F) in vivo. The results indicate a weak sigma(F)-specific -10 consensus, GG/tNNANNNT, of which the ANNNT portion is common to all sporulation-associated sigma factors, as well as to sigma(A). There was a rather stronger -35 consensus, GTATA/T, of which GNATA is also recognized by other sporulation-associated sigma factors. The looseness of the sigma(F) promoter requirement contrasts with the strict requirement for sigma(A)-directed promoters of B. subtilis. It suggests that additional, unknown, parameters may help determine the specificity of promoter recognition by E-sigma(F) in vivo.

FIG. 1

Determination of the 5′ end of spoIIQ mRNA by primer extension analysis. RNA was extracted from strain SL5618 (spoIIIGΔ1) 4 h after the end of exponential growth. Primer extension analysis was done with primer IIQ2 (TCAGCCAACGGATCCTTTACC, positions +161 to +181 from the inferred transcription start point) (A) and primer IIQ10 (CTGATTGATACCAAAGGAC, positions +128 to +147 from the inferred transcription start point) (B). Sequencing ladders using the same primers are also shown. The likely transcription start site is indicated by an asterisk.

FIG. 2

Sequence alignment of promoter regions for E-ς^F-transcribed genes for which the transcription start site has been inferred by primer extension analysis. Of these, only spoIIQ, spoIIR, and katX are not also recognized by E-ς^F (–, , , , , , –39). Asterisks indicate spaces introduced to adjust the spacing between the −10 and −35 consensuses. The underlined bases indicate the inferred transcription start points.

FIG. 3

Effect of induction of ς^F on expression of lacZ associated with different spoIIQ promoter regions. Synthesis of ς^F was induced by addition of IPTG to strains containing the structural gene for ς^F, spoIIAC, under the control of the P_spac promoter (41). Shown are strains with alterations to the −10 region (A) and the −35 region (B) of the promoter directing lacZ. Cultures were grown in MSSM to an optical density at 600 nm of 0.3. They were then divided in two, and 1 mM IPTG was added to one of each pair. None of the cultures displayed significant β-galactosidase activity in the absence of IPTG. (A) SL7472/EIA100 (P_spoIIQ [−200 to −38]) symbols: ⧫, no IPTG; ◊, 1 mM IPTG. SL7472/R10-103 symbols: ▴, no IPTG; ▵, 1mM IPTG. SL7472/R10-333 symbols: ●, no IPTG; ○, 1 mM IPTG. SL7472/R10-435 symbols: ■, no IPTG; □, 1 mM IPTG. SL7472/R10-901 symbols: ×, no IPTG; ∗, 1 mM IPTG. SL7472/R10-1024 symbols: +, no IPTG; −, 1 mM IPTG. Samples grown in the absence of IPTG produced little or no β-galactosidase, and symbols for the different cultures largely mask each other. (B) SL7472/R35-10 symbols: ⧫, no IPTG; ◊, 1 mM IPTG. SL7472/R35-20 symbols: ▴, no IPTG; ▵, 1 mM IPTG. SL7472/R35-43 symbols: ■, no IPTG; □, 1 mM IPTG. SL7472/R35-53 symbols: ●, no IPTG; ○, 1 mM IPTG. wt, weight.