Myopodin, a synaptopodin homologue, is frequently deleted in invasive prostate cancers

Abstract

Prostate cancer is one of the leading causes of cancer-related deaths for men in the United States. Like other malignancies, prostate cancer is underscored by a variety of aberrant genetic alterations during its development. Although loss of heterozygosity or allelic loss is frequently identified among prostate cancers, few genes have been identified thus far as critical to the development of invasive prostate cancers. In this report, we used the recently developed technology, the "differential subtraction chain," to perform a genome-wide search for sequences that are deleted in an aggressive prostate cancer. Among the deleted sequences, we found that one sequence was deleted in >50% of prostate cancers we tested. We mapped this sequence to chromosome 4q25 by screening the Genebridge 4 hamster radiation panel with primers specific to this probe, and subsequently identify a 54-kb minimal common deletion region that contains the sequence encoding myopodin. Sequence analysis indicates that myopodin shares significant homology with synaptopodin, a protein closely associated with podocyte and neuron differentiation. Further study shows that frequent complete or partial deletions of the myopodin gene occurred among invasive prostate cancer cases (25 of 31 cases, or 80%). Statistical analysis indicates that deletion of myopodin is highly correlated with the invasiveness of prostate cancers, and thus may hold promise as an important prognostic marker for prostate cancers.

Figure 1.

DSC enrichment of amplicons that are deleted in prostate cancer. A: Agarose electrophoresis of DSC products using blood amplicons (EcoRI) as testers and tumor amplicons (EcoRI) as drivers, after round 0 (lane 1), round 1 (lane 2), round 2 (lane 3), and round 3 (lane 4) of subtraction. B: Screening of DSC products from round 2 and round 3 DSC of A with ³²P-labeled tumor amplicons or blood amplicons. C: Electrophoresis of PCR products from selected primers using microdissected genome templates from tumor (lanes 2, 4, 6, 8, 10, 12, 14, and 16) and its matched blood cells (lanes 1, 3, 5, 7, 9, 11, 13, and 15) with primers11D (lanes 1 and 2), 12D (lanes 3 and 4), 12C (lanes 5 and 6), 1E (lanes 7 and 8), 1F (lanes 9 and 10), 5F (lanes 11 and 12), 1G (lanes 13 and 14), and 12G (control primers, lanes 15 and 16).

Figure 2.

Genome deletion analysis of prostate cancer. A: Survey of genomes of 18 primary prostate cancers and prostate cancer cell lines by PCR using a pair of primers specific to DSC probe 12C. Fifty ng of microdissected or cell line genomic DNA was used in the reaction. The experiments were repeated twice. A pair of primers away from chromosome 4q were used as control (4E AGTAGAGAGTGCTGGTCCACCTAG/AGGCATACTCTAGAAGACAGAGGC) (bottom). Primer sequences for 12C are GTATTCTAGCAAACCTGCTTAGCC/GGGCAGGGCAGTACCAAGGATGGC. B: Mapping the sizes of deletion in the genomes of prostate cancers. Chromosome 4 STS markers adjacent to DSC probe 12C were used as primers in PCR to map the sizes of the deletions. Twenty-five to 100 ng of genomic DNA were used as templates in each reaction. DNA from the blood of the same patients and microdissected normal donor DNA were used as a control for each marker. The green line represents normal human genome. The black lines next to each case represent deletions. The line proportion of the map may not be interpreted as the exact size of physical deletion. Probe 12C was located between markers D4S832 and WI-11817.

Figure 3.

Sequence of myopodin gene and its homology with synaptopodin and other proteins. A: Nucleotide sequence and the predicted amino acid sequence of myopodin. The open reading frame of myopodin predicts a 698-amino acid protein. B: Amino acid sequence homology of myopodin with synaptopodin. Significant homology between myopodin and synaptopodin were found in six stretches of sequences of myopodin. C: Homology of myopodin sequence with several other proteins. An acidic amino acid-rich domain was found in the N-terminal sequence of myopodin, and it shares significant homology with several nuclear localization proteins.

Figure 4.

Expression distribution of myopodin. A: Northern blot analysis of myopodin expression in 23 organ tissues. Twenty μg of total RNA of pancreas (lane 1), kidney (lane 2), skeletal muscle (lane 3), liver (lane 4), lung (lane 5), placenta (lane 6), brain (lane 7), heart (lane 8), leukocytes (lane 9), testes (lane 10), colon (lane 11), ovary (lane 12), small intestine (lane 13), prostate (lane 14), thymus (lane 15), spleen (lane 16), stomach (lane 17), thyroid (lane 18), spinal cord (lane 19), lymph node (lane 20), trachea (lane 21), adrenal gland (lane 22), and bone marrow (lane 23) were electrophoresed, Northern transferred to nylon membranes, and hybridized with a probe derived from exon 2 of myopodin. β-actin was used as the positive controls. B: In situ hybridization of prostate tissues with myopodin gene. A case of prostate cancer with deletion of myopodin gene was hybridized with a cocktail of digoxigenin-labeled antisense oligonucleotides corresponding to exon 2 of myopodin. H&E stain (left) and in situ hybridization (right) of the sections were shown for normal (top) and carcinoma (bottom).

Figure 5.

Partial deletion of myopodin gene in prostate cancers. A 2.4-kb intron separates exon 1 and exon 2 of myopodin. The exon/intron boundary for myopodin is identified by mapping the mRNA sequence of myopodin to human genome draft through NCBI’s BLAST program. Nonshaded area represents noncoding region, and green-shaded area represents coding sequence. represents acidic amino acid domain. The black stripes represent sequences containing homology with synaptopodin. PCRs were performed on genomic DNA of a panel of 39 cases of prostate cancers using primers in Table 1▶ to determine the presence of partial deletion. Deletions were further confirmed by sequencing on the PCR products.