Effect of different concentrations of H-NS protein on chromosome replication and the cell cycle in Escherichia coli

Abstract

Flow cytometric analysis showed that the hns205 and hns206 mutants, lacking the abundant nucleoid-associated protein H-NS, have decreased origin concentration, as well as a low number of origins per cell (ploidy). The most striking observation was that the low ploidy was due to a very short replication time, e.g., at 30 degrees C it was halved compared to that of the hns(+) strain. The decreased origin concentration was not caused by a decreased dnaA gene expression, and the hns206 mutant had normal DnaA protein concentrations. The replication phenotypes of the hns206 mutant were independent of RpoS. Cells overproducing H-NS from a LacI-controlled plasmid had a normal origin concentration, indicating that H-NS is not controlling initiation. A wild-type H-NS concentration is, however, required to obtain a wild-type origin concentration, since cells with an intermediate H-NS concentration had an intermediate origin concentration. Two lines of evidence point to an indirect effect of H-NS on initiation. First, H-NS did not show high-affinity binding to any part of oriC, and H-NS had no effect on transcription entering oriC from the mioC promoter. Second, in a shift experiment with the hns206 mutant, when H-NS protein was induced to wild-type levels within 10 min, it took more than one generation before the origin concentration started to increase.

FIG. 1.

Construction of expression vectors. The starting point for the T7 promoter expression vectors was plasmid pFHC2003, a pGEMEX-1 derivative lacking the XbaI fragment (positions 30 to 942 in GenBank under accession no. X65317) and with the NdeI site filled in with Klenow polymerase. Two oligonucleotides were synthesized to form a HindIII-XbaI multiple cloning site (MCS) adapter with an NdeI site encompassing a translation start signal (underlined) positioned favorably to a good Shine-Dalgarno sequence (double underline). This adapter was used to replace the HindIII-XbaI sequences of pFHC2003 to construct pFHC2006[rom⁻]. A rom⁺ derivative, pFHC2013, was constructed by combining the Eco47III-AatII fragment of plasmid pFHC2004 (pBR322 with the NdeI site filled in with Klenow polymerase) and the AatII-SmaI fragment of pFHC2006. Thus, pFHC2013 carries the origin and the bla gene from pBR322, whereas pFHC2006 carries the corresponding pUC variants. The T7 promoter was removed from plasmids pFHC2006 and pFHC2013 by replacing an XbaI-BglII fragment with an adapter formed by oligonucleotides 5.6 (CTAGAGCTCGAGTACTGTCGACA) and 5.7 (GATCTGTCGACAGTACTCGAGCT) to produce plasmids pFHC2069 and pFHC2070. Finally, an XhoI fragment carrying lacP(A1/04/03) and lacI from pFHC2014 (a derivative of pBEX5BA [21], wherein an SphI site was treated with T4 DNA polymerase to remove this site and an overlapping NsiI site) was inserted into the plasmids pFHC2069 and pFHC2070 cut with XhoI and SalI to construct the two new lac promoter cloning vectors pFHC2101[rom⁻] (GenBank accession no. AY070364) and pFHC2102[rom⁺] (GenBank accession no. AY070365).

FIG. 2.

Initiation synchrony. Strains BBC119, TC4061 (hns205), and TC4136 (hns206) were grown in AB glucose-Casamino Acids medium at the indicated temperatures. Samples were treated with rifampin and cephalexin and fixed, stained, and analyzed by flow cytometry.

FIG. 3.

Schematic representation of the cell cycles in wild type and hns206 mutant at 30°C as a function of time. Nonreplicating chromosomes are drawn as lines with the small circle symbolizing the origin. Replicating chromosomes are shown as forked or multiforked lines. Cell mass is reflected in the relative size of the cells assuming that the difference between wild type and mutant leads to proportional changes in width and length. Division (d), initiation (i), and termination (t) are indicated along the line representing the successive cycles.

FIG. 4.

Flow cytometric cell size distributions of strains BBC119, TC4061 (hns205), and TC4136 (hns206) grown in AB glucose-Casamino Acids medium at 30°C.

FIG. 5.

Flow cytometry analysis of cells containing increasing amounts of H-NS protein. Strain TC4617 (hns206 pTAC4617) was grown at 30°C in glucose-Casamino Acids-supplemented medium. The culture was divided into parts that received different amounts of IPTG. After four generations, samples were taken for analysis of the amount of H-NS protein by immunoblot and for analysis of cell size, DNA content, and origin distributions by flow cytometry. The concentration of H-NS relative to the hns⁺ strain TC3983 is given to the right of each row of panels, together with the generation time (t_D) in min. ND, the t_D could not be determined for this culture since growth slowed down progressively after induction. Panels: A to C, no IPTG; D to F, 0.125 mM IPTG; G to I, 0.15 mM IPTG; J to L, 0.18 mM IPTG. g.e., genome equivalents.

FIG. 6.

Origin concentration and ploidy as a function of H-NS concentration. Strains TC4617 (hns206 pTAC4617) and TC3983 (hns⁺) were grown at 30°C in glucose-Casamino Acids-supplemented medium. The TC4617 culture was divided into parts that received different amounts of IPTG. After four generations samples were taken for analysis of the amount of H-NS protein by immunoblot and for analysis of cell size and origins per cell by flow cytometry. The concentration of H-NS and origins/light scatter (LS) values are given relative to the values of strain TC3983. Symbols: ▪, TC4617; □, TC3983.

FIG. 7.

Effect of the hns206 mutation on mioC transcription. At the top is a map of the oriC region contained in pTAC1257. Abbreviations: E, EcoRI; H, HindIII; S, SmaI; V, EcoRV; X, XhoI. Triangle, promoter; rectangles, DnaA boxes (black = consensus boxes; gray = consensus with 1 misfit). Black lines indicate the location of regions of bend DNA according to Kimura et al. (29). The extent of mioC DNA carried by the different fusions is given below, together with the specific β-galactosidase activity in cultures grown at 30°C in glucose-Casamino Acids-supplemented medium.

FIG. 8.

Kinetic analysis of initiation after H-NS induction. Strain TC4617 (hns206 pTAC4617) was grown at 30°C in glucose-Casamino Acids-supplemented medium. At time zero, IPTG was added to 0.3 M for 10 min, and then the culture was diluted to obtain an IPTG concentration of 0.13 mM. Samples were taken before and after the shifts for analysis of the amount of H-NS protein by immunoblot and for analysis of cell size and origins per cell by flow cytometry. The concentration of H-NS and origins/light scatter (LS) are given relative to the values of the hns⁺ strain TC3983.