Developmental specificity of recruitment of TBP to the TATA box of the human gamma-globin gene

Abstract

It is unclear whether the core promoter is involved in developmental regulation. To address this question, we mutated the TATA box of the human gamma-globin gene, produced transgenic mice, and examined the effect of the mutation during the course of mouse development. In our test system, the gamma-globin gene is expressed at similar levels in the embryonic and adult erythroid cells. The TATA box mutation dramatically reduced expression of the gamma-globin gene in the adult but not in embryonic erythroid cells. In addition, the disruption of the gamma TATA box significantly reduced the recruitment of TATA box-binding protein (TBP) in the adult cells, but not in embryonic cells, suggesting that the recruitment of TBP to the gamma gene promoter is developmentally specific. Similarly, the recruitment of transcription factor II B and RNA polymerase II to the gamma promoter was affected in the adult but not in embryonic cells. The distinct effects of the TATA mutation in the embryonic and adult developmental stages suggest that the basal transcription apparatus can be recruited to a core promoter in a developmental stage-dependent manner. The TATA mutation resulted in a shift of transcription initiation site 6 bp or longer upstream to the cap site both in the embryonic and adult erythrocytes. We conclude that the TATA box determines the initiation site but not the efficiency of transcription of the gamma-globin gene.

Figure 1

The in vitro γ-globin gene expression depends upon an intact TATA box and recruitment of TBP. (A) The γTATA binds TBP, and the mutation of the γTATA abrogates the TBP binding. Gel shift assays were carried out as described (20). The mutated TATA box fails to bind TBP (lane 8) and to compete away the TBP binding on the wild-type TATA box (lane 4 and 5). The sequences of the double-stranded oligonucleotides used as probes were: γ TATA box, 5′GGATGAAGAATAAAAGGAAGCACCCT3′; γ mut TATA box, 5′GGATGAAGAGCTAGCGGAAGCACCCT3′. (B) The TATA box mutation abolishes transcription of the γ-globin gene. In vitro RNA transcription assays were performed by using nuclear extracts from MEL or K562 cells. The DNA templates used in the assays were μLCR(−382)^Aγ (lanes 1, 3, 4, and 6) and μLCR(−382)^Aγ(mut TATA) (lanes 2 and 5). α−Amanitin was added in the assays shown in lanes 3 and 6. (C) In vitro γ-globin gene transcription is inhibited by addition of the TATA box oligonucleotide (lane 2) into the assay system but not by poly(dI-dC) or the oligonucleotide with mutated TATA box. (D) TBP heat inactivation. The plasmid HS2γLuc and HeLa nuclear extract were used for in vitro transcriptions (lane 1). Lane 2: HeLa nuclear extracts were treated at 47°C for 10 min before in vitro transcription assay. Lane 3: purified TFIID (TBP) was added into the heat-treated HeLa nuclear extract.

Figure 2

Real-time PCR-based ChIP assay. (A) Representative data generated by LightCycler (Roche Molecular Biochemicals) showing the amplification curve of three different amounts of DNA along with a control (extreme Right). Human genomic DNA was amplified by using a pair of primers covering the TATA box of the γ-globin promoter. The x axis indicates the cycle number and the y axis indicates the intensity of fluorescence (F1) in logarithmic scale (arbitrary units). The plot of DNA concentration vs. the cycle threshold number is shown in B, indicating the linear correlation between DNA template (0.5 to 50 ng) and products. (C) Sizing of the products with agarose electrophoresis. Lane 1, size ladder; lane 2, γ TATA box region (100 bp); lane 3, murine ɛy promoter region (200 bp); lane 4, murine β^maj promoter region (170 bp). (D) Melting curves of the PCR products of γ TATA box region (lane 1), ɛy promoter (lane 2), and β^maj promoter (lane 3). x axis, temperature (°C); y axis, dF1/dT. The specificity of TBP antibody was tested by comparing the recovery of TATA box immunoprecipitated by TBP antibody to that by nonspecific antibody (E). Mouse brain served as control tissue nonexpressing the γ-globin gene (E).

Figure 3

Recruitment of TBP, TFIIB, and Pol II in the transgenic mice carrying the TATA box-mutated γ-globin gene. The day-11 yolk sac and adult spleen were harvested from transgenic mice carrying the wild-type γ construct [μLCR(−382)^Aγ] or the TATA box mutated construct [μLCR(−382)^Aγ(mut TATA)] and were subjected to real-time PCR quantitative ChIP assay with antibodies against TBP (A), TFIIB (B), and Pol II (C), respectively. Triplex real-time PCR was performed, and the recruitment of each factor to the endogenous ɛy promoter in yolk sac or β^major promoter in spleen was examined as internal control, respectively. The relative recruitment level of a factor to the TATA box-mutated γ promoter was calculated by the following formula: (γ-ChIP/γ-copy number)/control-ChIP, where “γ-ChIP” and “control-ChIP” mean the recoveries of the specific anti-body IP of the γ TATA box and ɛy (or β^maj) promoter, respectively. The recruitment in the wild-type control (black bar) was converted to 100%, and the recruitment in the TATA box mutated γ promoter (gray bar) was expressed as a percentage of the control.

Figure 4

Transcription initiation site of the TATA box-mutated γ-globin gene. Total RNA from yolk sac or adult blood was hybridized with a ³²P-labeled RNA probe spanning exon 1 to −382 promoter of the γ-globin gene. After RNase digestion, the protected fragments were separated on a 6% denatured polyacrylamide gel. Lane 1 is the wild-type control, and the protected band represents the +1 position. The initiation site of the mRNA transcribed from the TATA box-mutated γ-globin gene is shown in lane 2 (d10 yolk sac) and lane 3 (adult blood). The abnormal initiation sites are marked by asterisks.