A Krüppel-associated box-zinc finger protein, NT2, represses cell-type-specific promoter activity of the alpha 2(XI) collagen gene

Abstract

Type XI collagen is composed of three chains, alpha 1(XI), alpha 2(XI), and alpha 3(XI), and plays a critical role in the formation of cartilage collagen fibrils and in skeletal morphogenesis. It was previously reported that the -530-bp promoter segment of the alpha 2(XI) collagen gene (Col11a2) was sufficient for cartilage-specific expression and that a 24-bp sequence from this segment was able to switch promoter activity from neural tissues to cartilage in transgenic mice when this sequence was placed in the heterologous neurofilament light gene (NFL) promoter. To identify a protein factor that bound to the 24-bp sequence of the Col11a2 promoter, we screened a mouse limb bud cDNA expression library in the yeast one-hybrid screening system and obtained the cDNA clone NT2. Sequence analysis revealed that NT2 is a zinc finger protein consisting of a Krüppel-associated box (KRAB) and is a homologue of human FPM315, which was previously isolated by random cloning and sequencing. The KRAB domain has been found in a number of zinc finger proteins and implicated as a transcriptional repression domain, although few target genes for KRAB-containing zinc finger proteins has been identified. Here, we demonstrate that NT2 functions as a negative regulator of Col11a2. In situ hybridization analysis of developing mouse cartilage showed that NT2 mRNA is highly expressed by hypertrophic chondrocytes but is minimally expressed by resting and proliferating chondrocytes, in an inverse correlation with the expression patterns of Col11a2. Gel shift assays showed that NT2 bound a specific sequence within the 24-bp site of the Col11a2 promoter. We found that Col11a2 promoter activity was inhibited by transfection of the NT2 expression vector in RSC cells, a chondrosarcoma cell line. The expression vector for mutant NT2 lacking the KRAB domain failed to inhibit Col11a2 promoter activity. These results demonstrate that KRAB-zinc finger protein NT2 inhibits transcription of its physiological target gene, suggesting a novel regulatory mechanism of cartilage-specific expression of Col11a2.

FIG. 1.

Alignment of mouse NT2 and human FPM315 amino acid sequences. The sequence of the mouse clone NT2 (upper sequence, M; GenBank no. AF499776) is compared with that of human FPM315 (lower sequence, H; GenBank no. AC004232) (56). Numbers refer to amino acid positions in the mouse protein. Vertical lines denote amino acid identities. Boxes outline nine conserved zinc finger motifs. The boldface underlining indicates the KRAB-A subdomain, and the thin underlining indicates the LeR domain.

FIG. 2.

mRNA and protein expressions of NT2 in various tissues and cell types. (A) Analysis of NT2 expression in newborn mouse tissues by Northern blotting. For each lane, 20 μg of total RNA from various tissues was loaded, transferred to the nylon membrane, and hybridized with labeled NT2 cDNA. NT2 mRNA was strongly expressed in the brain, thymus, spleen, and rib cartilage. Lane 1, brain; lane 2, thymus; lane 3, heart; lane 4, liver; lane 5, spleen; lane 6, kidney; lane 7, skeletal muscle; lane 8, rib cartilage. (B) Total RNA (20 μg/lane) extracted from various cells was analyzed by Northern blotting using the NT2 cDNA probe. NT2 mRNA was highly expressed in BALB/3T3, 10T1/2, undifferentiated ATDC5, and MC3T3 cells (ATDC5 is a chondrocytic cell line and MC3T3 is an osteoblastic cell line), whereas low expression was seen with RCS cells (RCS is a rat chondrosarcoma cell line). Lane 1, BALB/3T3; lane 2, 10T1/2; lane 3, undifferentiated ATDC5; lane 4, RCS; lane 5, MC3T3; lane 6, ROS17/2.7; lane 7, L6; lane 8, C2C12. The lower panels show ethidium bromide-stained gels. (C) Western blot analysis of NT2 protein expression in cell lines. Nuclear extracts (2 μg) from cells were fractionated by SDS-PAGE, blotted, and incubated with NT2 antibodies. In vitro-translated NT2 (2 μg) was also subjected to Western blot analysis. To show the specificity of NT2 antibodies, the antibodies with NT2 reactivity depleted by NT2-Sepharose affinity column chromatography were also used as a control (ΔNT2 antibody). Lane 1, in vitro-translated NT2; lane 2, NIH 3T3; lane 3, undifferentiated ATDC5; lane 4, RCS; lane 5, NIH 3T3 with ΔNT2 antibody; lane 6, undifferentiated ATDC5 with ΔNT2 antibody. Protein standards are indicated on the left. The arrowhead indicates the NTZ protein band. (D) DNA binding of NT2 in cells to the labeled wild-type Col11a2 promoter. The 24-bp DNA sequence CAGGGAGGAGGGAGAGCGGCTGCT was used to prepare a double-stranded probe. EMSAs were performed with nuclear extracts from RCS (lanes 1 and 2), NIH 3T3 (lanes 3 and 4), and undifferentiated ATDC5 (lanes 5 and 6) cells. The presence (+) or absence (−) of antibodies against NT2 is indicated. The large arrow indicates NT2-promoter complexes (lanes 3 and 5). The small arrow marks supershifted NT2-promoter complexes by the anti-NT2 antibodies (lanes 4 and 6). The arrowheads indicate RCS cell-specific protein-promoter complexes (lanes 1 and 2). These complexes are specific to RCS cells and are not found in either NIH 3T3 or undifferentiated ATDC5 cells and are not supershifted by anti-NT2 antibodies.

FIG. 3.

In situ hybridization of longitudinal sections of the radius or forebrain of 16.5-day-old mouse embryos with antisense Col11a2, Col10a1, and NT2 or with sense NT2 riboprobes labeled with digoxigenin-11-UTP. (A) Staining with hematoxylin and eosin of the radius in the forelimb. h, hypertrophic chondrocytes; r, resting chondrocytes; p, proliferating chondrocytes. (B) Expression of Col11a2 in a semiserial section. Strong signals of Col11a2 were detected in the resting and proliferating chondrocytes. (C) Expression of Col10a1 was observed in hypertrophic chondrocytes. (D) NT2 mRNA was highly expressed in the hypertrophic zone; however, its expression was very weak in the resting and proliferative zones. The localization of NT2 mRNA was similar to that of Col10a1, a marker gene of hypertrophic chondrocytes. (E) Sense NT2 riboprobes showed no signals in the serial section. (F) Expression of NT2 mRNA in the forebrain of 16.5-day-old mouse embryos. Expression of NT2 was observed in the frontal cortex (fc) of the forebrain. (G) Higher magnification of the frontal cortex demonstrates that the signal for NT2 mRNA was detected in the marginal zone (mz), cortical plate (cp), and ventricular zone (vz) but was weak in the intermediate zone (im). (H) Sense NT2 riboprobes showed no signals in the brain section.

FIG. 4.

In situ hybridization of axial sections of 8.5- (A), 9.5- (B), and 12.5- (C and D)day-old mouse embryos with antisense or sense NT2 and Col11a2 riboprobes labeled with digoxigenin-11-UTP. The signals for NT2 mRNA were ubiquitous but were almost absent in the neural tube and somites in the 8.5- and 9.5-day-old mouse embryos (A and B). The sense NT2 probes showed no signals in the serial section of 9.5-day-old embryos (C). In the 12.5-day-old embryo, Col11a2 mRNA was strongly expressed at the mesenchymal condensations for rib and vertebral cartilage primordia (D), whereas NT2 mRNA was not expressed in these locations (F). Negative controls using sense Col11a2 (E) and NT2 (G) showed no signals in the semiserial sections. lb, limb bud; nt, neural tube; r, rib cartilage primordia; s, somite; v, vertebral cartilage primordia.

FIG. 5.

Expression of NT2 in differentiating ATDC5 cells in vitro. ATDC5 cells were cultured with 10-μg/ml bovine insulin for differentiation. After 2 weeks in culture under confluent conditions, the cells differentiated into the proliferative chondrocyte phenotype and formed nodules. The nodule- and nonnodule-forming cell populations were separated using sharp forceps under a stereomicroscope, and total RNA (20 μg/lane) from the two cell populations was electrophoresed in each lane, transferred to a nylon membrane, and hybridized with NT2, Col11a2, and Col10a1 cDNA probes as indicated at the left of the panels (lanes 1 and 2). The nodule-forming cells then differentiated into the hypertrophic chondrocyte phenotype after the cells were incubated for 5 weeks. The total RNA was extracted and subjected to Northern blot analysis (lane 3). NT2 mRNA was strongly detected in undifferentiated cells (lane 1), but the expression level was decreased when the cells differentiated into the proliferative chondrocyte and began to express Col11a2 (lane 2). As the expression of the collagen types was switched from Col11a2 to Col10a1 in differentiating ATDC5 cells, NT2 expression was induced again (lane 3). The lower panels show the ethidium bromide staining of the gel.

FIG. 6.

Specific DNA binding of NT2 to Col11a2 promoter analyzed by EMSA. (A) The gene structure of the promoter (−742 to +1) and exon 1 of Col11a2. The 3′-portion of the retinoid X receptor β gene (Rxrb) was indicated. The coding strand sequences of the WT oligonucleotide probes corresponding to the target sequence (−530 to −507) for the yeast one-hybrid screening and the competitors with substitution mutations (M1 through M12) used in EMSA were also indicated. Only mutated nucleotides are shown. (B) In the left panel, lane 2 shows that NT2 bound to the WT Col11a2 promoter sequence. Lanes 3 to 6 show competition between the labeled WT probe and the 50-fold molar excess of cold probes. Lane 1, no competitor. DNA binding of NT2 was inhibited by the addition of WT or M3, whereas M1 and M2 probes showed minimal inhibition. The right panel shows that the DNA binding of NT2 to labeled WT oligonucleotides (lane 7) was inhibited by addition of cold WT (lane 8), M4 (lane 9), M5 (lane 10), M11 (lane 16), and M12 (lane 17) probes. The M6, M7, M8, M9, and M10 probes did not affect the binding of NT2 to the promoter (lanes 11 to 15), indicating that the core binding sequence of NT2 in the promoter is GAGGAGGGAG. Lane 7, no competitor.

FIG. 7.

Cotransfection experiments showing the suppressive effect of NT2 on Col11a2 promoter activity. RCS cells were transiently transfected with 2 μg of reporter plasmid (pGL3-Control, p530luc, or p530Mluc) along with a total of 4 μg of pCA1F expression vector that either did or did not contain the NT2 cDNA as indicated. NT2 reduced Col11a2 promoter activity of p530luc to 21% of the control in a dose-dependent manner, whereas it did not affect the luciferase activity of the pGL3-Control plasmid driven by the SV40 promoter. NT2 did not affect the luciferase activity of p530Mluc, which has substitution mutations at the NT2 binding site. A Renilla luciferase expression vector, pRL-SV40, was used as an internal control for transfection efficiency. The relative luciferase activities are average values ± the standard errors for three independent transfected cultures from two repeated experiments.

FIG. 8.

The effect of deletions in NT2 on the inhibition of Col11a2 promoter activity. (A) Full-length FPM315 has an LeR domain, a KRAB-A subdomain and nine zinc finger motifs as reported by Yokoyama et al. (56). In NT2Δ4, the KRAB-A subdomain of NT2 is deleted. The predicted molecular weight of each protein is indicated at the right of the panel. (B) Western blot analysis of deletion mutant NT2 proteins. In vitro-translated proteins (2 μg) were fractionated by SDS-PAGE, blotted, and incubated with anti-Flag antibodies. Lane 1, full-length NT2; lane 2, NT2Δ1; lane 3, NT2Δ2; lane 4, NT2Δ3; lane 5, NT2Δ4. Protein standards are indicated on the left. (C) Cotransfection experiments showing the effect of the KRAB-A subdomain in NT2 on Col11a2 promoter activity. RCS cells were transiently transfected with 2 μg of p530luc along with a total of 4 μg of pCA1F expression vector that either did or did not contain the deleted NT2 cDNA as indicated. Full-length NT2 and NT2Δ1 significantly inhibited Col11a2 promoter activity, consistent with the data shown in Fig. 7. However, NT2Δ2 and NT2Δ3 did not affect the luciferase activity of p530luc. Furthermore, NT2Δ4 also failed to inhibit Col11a2 promoter activity. pRL-SV40 was used as an internal control for transfection efficiency. The relative luciferase activities are average values ± the standard errors for three independent transfected cultures from two repeated experiments.