Tissue-specific silencing of a transgene in rice

Abstract

In a transgenic rice line, a beta-glucuronidase reporter gene under the control of the rice tungro bacilliform virus promoter became gradually methylated, and gene activity was lost concomitantly. Methylation was observed only in the homozygous offspring and was initially restricted to the promoter region and accompanied by loss of expression in the vascular bundle tissue only. This expression pattern was similar to that of a promoter with a deletion of a vascular bundle expression element. The gene activity could be reestablished by treatment with 5-azacytidine. Methylation per se did not inhibit the binding to the promoter region of protein factors which also bound to the unmethylated sequence. Instead, promoter methylation enabled the alternative binding of a protein with specificity for sequence and methylation. In further generations of homozygous offspring the methylation spread into the transcribed region and gene activity was completely repressed also in nonvascular cells. The results indicate that different stages are involved in DNA methylation-correlated gene inactivation, and that at least one of them may involve the attraction of a sequence and methylation-specific DNA-binding protein.

Fig 1.

Schematic map of the RTBV promoter constructs used for the generation of transgenic rice plants and Southern analyses of obtained lines. (A) The structure of the RTBV genome is shown in a linearized version on top, with the RTBV upstream promoter sequences (RTBV ups) as a gray box, the RNA leader sequence as a thin line, and the other ORFs as boxes. The positions of the splice donor (SD) and splice acceptor (SA) (77), the first short ORF in the leader (black box), and the RTBV polyadenylation signal (polyA) are marked. Sequence coordinates and positions with respect to the transcription start site (marked by a bent arrow at +1) are indicated, and the BstBI restriction sites used to generate the recombined intron (32) are shown. The GUS expression constructs mentioned in the text are shown below. GUS is fused to the RTBV ORF4, and translation of the spliced mRNA starts with the short ORF in the leader. In HRintG-680, the position of SphI (S), BamHI (B), and EcoRI (E) and the positions of probes (black bars) used for Southern analyses are shown. (B) Southern blot analysis of hemizygous R1 and R2 plants. Bands corresponding to predictable fragments are marked by arrowheads.

Fig 2.

Histological GUS staining of cross-sections of rice plantlets. The older leaf sheaths enclose the blade of the youngest leaf. (A) Line R1, hemizygous (T₂ generation): normal GUS expression of HRintG in vascular bundles and epidermal cells of the leaf blade and in vascular bundles and parenchyma cells of the leaf sheaths. (B) Line R1, homozygous (T₂): silenced expression in the vascular bundles, expression exclusively in epidermal cells. (C) Line HRintG-100 containing a GUS gene under control of a deletion variant of the RTBV promoter, which is only active in the epidermis. (D) Line R2, homozygous (T₃): expression exclusively in the epidermal cells. (E) Line R1, homozygous (T₃): almost completely silenced expression. (F) F₁ generation plant of a sexual cross between homozygous R2 and a nontransgenic plant. (G) F₂ generation plant (hemizygous) of the sexual cross in F. (H) Line R1, homozygous (T₂): restored expression in the vascular bundles after germination on 30 μM 5-AC.

Fig 3.

5-Methylcytosine mapping of RTBV [dps] promoter from position −229 to +114 in line R1. Completely (m) or partially (p) methylated cytosines are indicated. hem, hemizygous; hom, homozygous. The gap around +70 indicates a region for which no clear sequencing data could be obtained. Sites that were also analyzed by restriction analysis and promoter elements that bind proteins under our experimental conditions are indicated [VBE (40); AE, activator element (41); dps1 and 2, downstream promoter sequence (35, 61)].

Fig 4.

Methylation analysis of the ClaI site at the 5′ end of the transcribed region. A schematic presentation of the fragments obtained by ClaI, EcoRV, and SphI digestion with methylated and nonmethylated ClaI sites is shown (dps, downstream promoter sequences) together with the resulting Southern blot. 5-AC, seedlings germinated in the presence (+) or absence (−) of 5-AC; he, hemizygous; ho, homozygous; % meth, relative amounts of methylated DNA.

Fig 5.

Summary of restriction analyses of normally expressing and silenced lines. he, hemizygous; ho, homozygous; S, Sau3AI; H, HpaII; m, methylated; -, not methylated; p, partially methylated.

Fig 6.

Analysis of transgene-derived RNAs by RNase protection. (A) Schematic presentation of the expected protection pattern. dps, downstream promoter sequence; SD, splice donor site; SA, splice acceptor site; 5′, protected 5′ exon of the spliced RNA; 3′, protected 3′ exon of the spliced RNA. The region covered by the antisense probe used for the assay in B is shown schematically. Length of expected fragments is indicated. (B) RNase protection assay with total RNA isolated from the leaves of freshly germinated seedlings of untransformed and R1 rice plants; fragments are designated as in A. 5-AC, seedlings grown in the absence (−) or presence (+) of 30 μM 5-AC; MWM, molecular weight marker. (C) Quantification of RNA fragments from B and correlation to the respective GUS activity of the plants. Values are relative to the normally expressing hemizygous line R1 (= 100), and the stimulation factor for incubation with 30 μM 5-AC is given.

Fig 7.

Binding of nuclear proteins to methylated and unmethylated vascular bundle-specific enhancer region. DNA fragments covering the region −169 to −100 of the RTBV promoter (TAAGTACGAATCAATAAAGAAGAAGGACCAGAAGATATAAAGCGGGAACATCTTCACATGCTACCACATGGCT) were used either as is or methylated at their two CG and one CNG sites in EMSAs. Competitions were performed with 500-fold excess of unlabeled DNA fragments. V, VBE; Vm, methylated VBE; AEm, methylated sequence around the RTBV activator element GTAAGAGTGTGTAATGACCAGTGTGCCCCTGGACTC; asm, methylated sequence around the CaMV as1 element (CCACTGACGTAAGGGATGACGCACAATC). VBP, vascular bundle element-binding protein.