Central role of alpha7 nicotinic receptor in differentiation of the stratified squamous epithelium

Abstract

Several ganglionic nicotinic acetylcholine receptor (nAChR) types are abundantly expressed in nonneuronal locations, but their functions remain unknown. We found that keratinocyte alpha7 nAChR controls homeostasis and terminal differentiation of epidermal keratinocytes required for formation of the skin barrier. The effects of functional inactivation of alpha7 nAChR on keratinocyte cell cycle progression, differentiation, and apoptosis were studied in cell monolayers treated with alpha-bungarotoxin or antisense oligonucleotides and in the skin of Acra7 homozygous mice lacking alpha7 nAChR channels. Elimination of the alpha7 signaling pathway blocked nicotine-induced influx of 45Ca2+ and also inhibited terminal differentiation of these cells at the transcriptional and/or translational level. On the other hand, inhibition of the alpha7 nAChR pathway favored cell cycle progression. In the epidermis of alpha7-/- mice, the abnormalities in keratinocyte gene expression were associated with phenotypic changes characteristic of delayed epidermal turnover. The lack of alpha7 was associated with up-regulated expression of the alpha3 containing nAChR channels that lack alpha5 subunit, and both homomeric alpha9- and heteromeric alpha9alpha10-made nAChRs. Thus, this study demonstrates that ACh signaling through alpha7 nAChR channels controls late stages of keratinocyte development in the epidermis by regulating expression of the cell cycle progression, apoptosis, and terminal differentiation genes and that these effects are mediated, at least in part, by alterations in transmembrane Ca2+ influx.

Figure 1.

α-BTX blocks Nic-induced differentiation of human keratinocytes. The number of differentiation marker-positive keratinocytes (percentage of total cells) after incubation with 10 μM Nic alone (black bar), 10 μM Nic plus 1 μM αBTX (hatched bar), or without any additions (white bar) (control). The cells were either fixed and stained for the differentiation markers cytokeratin 10 (CK 10), human keratinocyte transglutaminase type I (Trgl), involucrin (Invn), or filaggrin (Flgrn) or used in the assay of cornified envelopes (CE). Data are means ± SD of two independent experiments. In each immunocytochemical experiment, the numbers of cells stained for a differentiation-associated protein using avidin–biotin complex/alkaline phosphatase technique (as described in Material and methods) were counted in at least three different microscopic fields.

Figure 2.

Role of α7 nAChRs in mediating spontaneous and Nic-induced ⁴⁵Ca^{2 +} influx into human keratinocytes. (A and B) Effects of α-BTX on transmembrane ⁴⁵Ca²⁺ influx. α-BTX decreased in a dose-dependent manner both spontaneous (A) and Nic-induced (B) influx of ⁴⁵Ca²⁺ into keratinocytes freshly isolated from human neonatal foreskins. The effects of test concentrations of α-BTX on baseline ⁴⁵Ca²⁺ influx were measured in cell aliquots suspended in KGM without Nic. The inhibitory effects of α-BTX on Nic-induced ⁴⁵Ca²⁺ influx into keratinocytes were measured in aliquots of keratinocyte suspensions in KGM containing 10 μM Nic. Cell aliquots were resuspended in serum-free keratinocyte medium (KGM) containing either 0.09 (black bar) or 1.2 (white bar) mM Ca²⁺, incubated for 15 min in a humid 5% CO₂ incubator, washed, and used in the ⁴⁵Ca²⁺ influx assay as described in Materials and methods. Data are means ± SD of representative experiments in which triplicate samples were measured. The concentrations of α-BTX are shown at the bottom of each graph. Asterisks indicate that the experimental data significantly (P < 0.05) differ from controls. (C and D) Effects of extracellular Ca²⁺ on expression of α7 nAChR in human keratinocytes. The level of α7 expression on the cell membrane was measured using the FITC-labeled α-BTX binding assay detailed in Materials and methods, and the total amount of cellular α7 protein was measured by Western blotting using rabbit anti-α7 antibody characterized in the past (Zia et al., 2000). Both 15- and 60-min preincubations increased cell surface binding of α-BTX (C). An increase of fluorescence intensity ratio (FIR) became statistically significant after 60 min of incubation (P < 0.05; denoted with an asterisk). By this point in time, the total amount of α7 protein increased by 32% (D). The α7 band appeared at the expected mol wt of 60 kD.

Figure 3.

Anti-α7 AsOs prevents high extracellular Ca^{2 +} -induced terminal differentiation of human keratinocytes. (A) Intracellular accumulation of FITC-labeled α7 AsOs. FITC-labeled AsOs (Table I), 20 nM, was added to the second passage human keratinocytes. Localized FITC-labeled AsOs was viewed live via phase–contrast fluorescence microscopy after a 24-h incubation (×400). Note that anti-α7 AsOs is distributed into the nucleus and the cytoplasm. Control oligonucleotide was similarly distributed (unpublished data). (B) Effect of anti-α7 AsOs on the α7 nAChR subunit protein in human keratinocytes. The cells were seeded in 24-well plates at a density of 5 x 10⁴/well and incubated in a 5% CO₂ incubator for 72 h in KGM in the presence of Lipofectamine Plus™ alone (control), 20 nM of sense oligonucleotide, or 20 nM of each of five phosphorothioated AsOs (Table I). The anti-α7 AsOs dramatically reduced the intensity of the 60-kD receptor band in the immunoblot. Control (i.e., sense) oligonucleotide did not alter the total amount of α7 protein. (C) Alterations in the expression of differentiation markers in keratinocytes treated with anti-α7 AsOs. Relative amounts of filaggrin, loricrin, and cytokeratins (CK) 1 and 10 were analyzed by Western blotting of the total protein isolated from human keratinocytes transfected with anti-α7 AsOs or the control oligonucleotide described above, or intact keratinocytes after 96 h incubation of these cells in KGM containing 1.2 mM Ca²⁺, to induce terminal differentiation.

Figure 4.

Reduced rate of keratinocyte cornification in the epidermis of α7 KO mice. (A) Representative PCR profiles of the homozygous and heterozygous mice from a progeny of a heterozygous α7^+/− mouse. Genomic DNA was extracted by a standard digestion method (Orr-Urtreger et al., 1997). The PCR primers were generated for intronic regions flanking exon 8 and 10 and used in experiments at the following concentrations: P1 (wild-type forward), CCTGGTCCTGCTGTGTTAAACTGCTTC (20 pmol); P2 (wild-type reverse), CTGCTGGGAAATCCTAGGCACACTTGAG (10 pmol); and P3 (KO), GACAAGACCGGCTTCCATCCGAGTAC (25 pmol). DMSO (1:20) was included in PCR reactions, and the annealing temperature was 56°C. The size of the gene product amplified from a wild-type mouse was 440 bp and that from α7^−/− mouse was 750 bp. The PCR analysis identifies the α7 homozygous-null (−/−) and wild-type (+/+) animals and the heterozygous (+/−) mouse. (B and C) Comparative histology of the skin of α7^+/+ (B) and α7^−/− (C) mice. The epidermis of wild-type mouse is comprised of basal keratinocytes attached to the epidermal basal membrane and a single suprabasal cell layer. In marked contrast, the epidermis of α7^−/− mouse, in addition to the basal layer, consists of several rows of suprabasal keratinocytes, including a superficially located layer of granular keratinocytes, and the uppermost stratum corneum, which is unusually loose and thick. Light microscopy of the hematoxylin and eosin stained 6-μm-thick cryostat sections of skin obtained from heads of 3-d-old α7^+/+ and α7^−/− mice. Magnification, ×200. Bar, 25 μm. (D) Analysis of the expression of keratinocyte differentiation proteins cytokeratin (CK) 1, CK 10, and filaggrin by RT-PCR. The mRNA levels of the keratinocyte differentiation markers were determined using specific PCR primers (Table II) and cDNA template from the skin of neonatal α7 KO and wild-type mice as described in Materials and methods. Amplification yielded PCR products of the expected sizes: 534 bp for filaggrin, 461 bp for CK 1, and 364 bp for CK 10. Amplification of the GAPDH gene product (354 bp) was used to normalize the cDNA content in each sample and as a positive control for RT-PCR effectiveness. (E) Analysis of the expression of keratinocyte differentiation proteins CK 1 and 10 and filaggrin by Western blotting. These markers of terminal differentiation were visualized at the expected mol wt (shown in kD on the left side of the gels) in the 15% SDS-PAGE–resolved proteins, 10 μg per lane, extracted from the skin of α7 KO and wild-type mice using specific antibodies, and all appropriate negative controls. (F) Semiquantitative IF analysis of relative amounts of differentiation markers in the epidermis of α7 KO and wild-type neonatal mice. The cryostat sections of the skin from killed mice were stained with antibodies specific for the keratohyalin granule proteins filaggrin (Flgrn), and loricrin (Lrcn), and the CK proteins 1 and 6 (Table III), and the relative amounts of these keratinocyte proteins in the epidermis of α7^+/+ (black bar) and α7^−/− (white bar) mice were determined using computer-assisted analyses of the specific IF tissue staining as detailed in the Materials and methods section. The assay revealed that although the expression of filaggrin, loricrin, and CK 1 was significantly decreased, that of CK 6 was significantly increased in α7^−/− compared with α7^+/+ mice (P < 0.05).

Figure 5.

Alterations in the cell cycle and apoptosis gene expression in α7 KO keratinocytes. (A) Analysis of the expression of keratinocyte cell cycle and apoptosis regulatory genes by RT-PCR. Total RNA was isolated from the second passage, ∼75% confluent monolayers of neonatal α7 homozygous-null (−/−) and wild-type (+/+) keratinocytes and used in the RT-PCR assays described in Materials and methods. Gene-specific RT-PCR primers were designed to amplify the murine cell cycle regulation genes coding for p53, Ki-67, cyclin D1, and PCNA, antiapoptotic Bcl-2, and the cell apoptosis marker gene caspase 3 (Table II). Each primer set yielded PCR product of expected size: 499 bp for Ki-67, 482 bp for cyclin D1, 307 bp for PCNA, 389 bp for p53, 376 bp for Bcl-2, and 494 bp for caspase 3. (B) Analysis of the expression of keratinocyte cell cycle and apoptosis regulatory genes by Western blotting. Total protein was isolated from the same cells as in A and used in the Western blotting assay described in Materials and methods. The mol wt of each protein is shown in kD to the right of the gels. Each protein band was visualized at the expected mol wt. Changes in the gene expression of each of the cell cycle and apoptosis markers detectable by Western blots were consistent with those determined by RT-PCR. (C) Semiquantitative IF analysis of relative amounts of keratinocyte cell cycle and apoptosis markers in the epidermis of α7 KO and wild-type neonatal mice. The cryostat sections of skin from killed mice were stained with antibodies specific for the cell cycle progression regulators Ki-67, PCNA, cyclin D1 (CyD1), and p53, and the marker of cell apoptosis caspase 3 (Cs3) (Table III), and the relative amounts of these keratinocyte proteins in the epidermis of α7^+/+ (black bar) and α7^−/− (white bar) mice were computed based on the relative intensity of specific IF staining as detailed in Materials and methods.

Figure 6.

Alterations in the α3, α5, α9, and α10 nAChR subunit gene expression in α7 KO keratinocytes. (A) The levels of α3, α5, α9, and α10 nAChR subunit gene transcription in α7^−/− keratinocytes. The detection of the nAChR subunit transcripts by RT-PCR was performed using gene specific primers for the murine α3, α5, α9, and α10 nAChR subunits (Table II) and cDNA from the second passage, ∼75% confluent monolayers of neonatal α7 homozygous null (−/−) and wild-type (+/+) mice as template. Each pair of primers yielded a PCR product of the expected size: 485 bp for α3, 480 bp for α5, 458 bp for α9, and 463 bp for α10. (B) The levels of α3, α5, α9, and α10 nAChR subunit gene translation in α7^−/− keratinocytes. The nAChR subunit proteins were visualized by Western blots of total proteins extracted from the same cells as in A. Results of a representative experiment showing protein bands recognized by rabbit polyclonal antibodies specific for α3, α5, α9, or α10 (Table III) resolved on 15% SDS-PAGE and immunoblotted as described in Materials and methods. The apparent mol wt of each receptor protein is shown in kD at the right side of the gel.