Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors

Abstract

Peroxisomes are cytoplasmic organelles which are important in mammals in modulation of lipid homeostasis, including the metabolism of long-chain fatty acids and conversion of cholesterol to bile salts (reviewed in refs 1 and 2). Amphipathic carboxylates such as clofibric acid have been used in man as hypolipidaemic agents and in rodents they stimulate the proliferation of peroxisomes. These agents, termed peroxisome proliferators, and all-trans retinoic acid activate genes involved in peroxisomal-mediated beta-oxidation of fatty acids. Here we show that the receptor activated by peroxisome proliferators and the retinoid X receptor-alpha (ref. 6) form a heterodimer that activates acyl-CoA oxidase gene expression in response to either clofibric acid or the retinoid X receptor-alpha ligand, 9-cis retinoic acid, an all-trans retinoic acid metabolite; simultaneous exposure to both activators results in a synergistic induction of gene expression. These data demonstrate the coupling of the peroxisome proliferator and retinoid signalling pathways and provide evidence for a physiological role for 9-cis retinoic acid in modulating lipid metabolism.

FIG. 1

PPAR and RXRα transactivate reporter expression cooperatively through the PPRE. a, The sequence of the PPRE located between nucleotides −558 and −570 of the AOX promoter is compared to that of the idealized DR-1 HRE. The positions of the AGGTCA direct repeats are indicated by arrows. X, nucleotide substitution in this motif, b, CV-1 cells were cotransfected with reporter construct AOX-LUC and either the control (CONT) Rous sarcoma-virus promotor-chloramphenicol acetyl transferase (RS-CAT) or expression plasmids RS-rat(r)PPAR (PPAR) and/or RS-human(h)RXRα (RXR) as indicated. Cells were subsequently treated with carrier dimethylsulphoxide (DMSO) (−) or hormones (+), including clofibric acid, 9-cis retinoic acid (RA), or clofibric acid and 9-cis RA as indicated. Luciferase activity Is presented as per cent normalized response where induced PPAR activity in the presence of clofibric acid is arbitrarily set at 100%. c, CV-1 cells were cotransfected with reporter construct PPRE₃-TK-LUC and either the control RS-CAT or expression plasmids RS-rPPAR and/or RS-hRXRα as Indicated. METHODS. Expression plasmid RS-rPPAR was constructed by inserting the rat PPAR cDNA (D.J.N., submitted) into the Kpnl/BamHl sites of pRS (ref. 6). The RS-human RXRα expression plasmid has been described. The reporter plasmid AOX-LUC was constructed by amplification from rat genomic DNA of the 5’ flanking sequences (nucleotides −602 to +20) of the rat AOX promoter by 30 cycles of the polymerase chain reaction (PCR) and directional insertion into BamHI/Xhol-cut. pLUC (ref. 12). Oligonucleotides for PCR contained BamHI (5’) and XhoI (3’) restriction sites to facilitate subcloning. The reporter construct PPRE₃-TK-LUC was constructed by inserting 3 copies of an oligonucleotide encoding the PPRE (GTCGACAGGGGA- CCAGGACAAAGGTCACGTTCGGGAGTCGAC)^– in direct orientation into the unique SaII site of the basal reporter construct TK-LUC (ref. 12). The orientation of the PPREs was confirmed by sequencing. Transfection assays were performed using CV-1 cells as described^, and modified for automation In 96-well plates. All transfections were performed on a Beckman Biomek Automated Workstation. Transfections contained 5.0 ng of receptor expression plasmid vector (or control RS-CAT), 50 ng of the reporter luciferase plasmid, 50 ng of pRS/3GAL (β-galactosidase) as an internal control, and 90 ng of carrier plasmid pGEM. Cells were transfected for 6 h, washed to remove DNA precipitates, and treated with hormones (1 × 10⁻³ M clofibric acid; 1 × 10⁻⁶ M 9-cis RA) for 36 h. Cell extracts were subsequently prepared and assayed for luciferase and β-galactosidase activities. All experiments were done In triplicate in at least two independent experiments and were normalized for transfection efficiency by using β-galactosidase as the internal control.

FIG. 2

Direct interactions between PPAR and RXRα in the absence or presence of DNA. a, PPAR and RXRα form a complex in solution. Immunoprecipitation was done using in vitro-synthesized [³⁵S]methionine- labelled PPAR in the presence of 150 ng of either bacterially expressed RXRα (lane 2) or control glutathione S-transferase (GST) (lane 1). Polyclonal antiserum prepared against RXRα was used. The position of immunoprecipitated PPAR is indicated by an arrow. Under identical conditions we failed to observe RXRα interactions with radiolabelled glucocorticoid receptor (data not shown, and ref. 14). b, PPAR and RXRα bind cooperatively to the PPRE. Gel mobility shift assays were done using in wtro-synthesized PPAR and/or RXRα as indicated, and ³²P-labelled PPRE oligonucleotide. Pre-immune (PI) or polyclonal antiserum prepared against RXRα (RXRab) were included in the reactions as indicated. METHODS. PPAR and RXRα RNA was prepared and translated in rabbit reticulocyte lysates as directed by the supplier (Promega). Coimmunoprecipi- tation reactions (20 μl) included 5 of in v/tro-synthesized [³⁵S]methion- ine-labelled PPAR and 150 ng of either bacterially expressed GST-RXR fusion protein or GST alone in 20 mM Tris, pH μl8.0. Proteins were incubated for 20 min on ice before the addition of 5 μl polyclonal antisera prepared against an RXRα peptide (amino acids 214–229). Antigen-antibody complexes were collected by the addition of protein A-Sepharose (Pharmacia) and the immunocomplexes washed three times with 400 μl RIPA buffer (10 mM Tris, pH 8.0, 150mMNaCI, 1% Triton X-100, 1% sodium deoxycholate). Immunoprecipitated complexes were resolved by SDS-polyacrylamide gel electrophoresis on 10% gels which were then fixed in 30% methanol/10% acetic acid, dried, and subjected to autoradiography. Gel mobility shift assays (20 μl) contained 10 mM Tris, pH 8.0,40 mM KCI, 0.05% NP-40,6% glycerol, 1 mM DTT, 0.2 μg poly(dl-dC) and in vitro-synthesized PPAR (2.5 μl) and RXRα (2.5 μl) as indicated in the figure legends. The total amount of reticulocyte lysate was maintained constant in each reaction (5 μl) through the addition of unprogrammed lysate. After a 10-min incubation on ice, 0.5–1 ng of ³²P-labelled oligonucleotide was added and the incubation continued for a further 10 min. DNA-protein complexes were resolved on a 4% polyacrylamide gel in 0.5 xTBE (1 xTBE is 90 mM Tris, 90 mM boric acid, 2mM EDTA, pH 8.0). Gels were dried and autoradiographed at −70°. The PPRE oligonucleotide was 5’-AGCTGGACCAGGACAAAGGTCACGT- TCAGCT-3’.

FIG. 3

Binding specificity of the PPAR-RXRα complex on synthetic and natural HREs. a, The binding specificities of the PPAR-RXRα, VDR-RXRα, TR-RXRα and VDR-RXRα complexes were tested by gel mobility shift analysis in the absence (–) or presence of a 4- or 16-fold molar excess of synthetic HREs, DR-0 to DR-5. Radiolabelled oligonucleotides encoding the PPRE, osteopontin VDRE, Moloney leukaemia virus (MLV) LTR TRE, and ß-RARE were used as radiolabelled probes in binding assays involving the PPAR- RXRα, VDR-RXRα, TR-RXRα and RAR-RXRα complexes, respectively. Only the regions of the autoradiographs displaying the bound complexes are shown. Asterisks indicate reactions in which maximal levels of competition were observed, b, The binding specificity of the PPAR-RXRα complex was tested using radiolabelled oligonucleotides encoding the PPRE, 3-ketoacyl- CoA thiolase (3KAT), cellular retinol binding protein type II (CRBPII), chicken ovalbumin (OVAL), DR-1, osteopontin (VDRE), MLV LTR (TRE), and ß-RAR (ß-RARE) HREs. The sequences of these HREs are shown on the right. METHODS. PPAR, RXRα, TRß, VDR and RXRα RNAs were prepared and translated in rabbit reticulocyte lysates as directed by the supplier (Promega). Gel mobility shift assays were done as for Fig. 2. The 3- keioacyl-CoA thiolase oligonucleotide was 5’-AGC- T CT C AG AGACCTTTGAACCA- CTTC-3’. The CRBPII-RXRE, ß-RARE, MLV TRE, osteo-pontin VDRE, chicken ovalbumin HRE, and synthetic HRE direct repeat series oligonucleotides have been described^,,.

FIG. 4

RXRα present in liver nuclear extracts enhances PPAR binding to the PPRE. Gel mobility shift assays were prepared using ³²P-labelled PPRE oligonucleotide and in vitro- synthesized PPAR and/or RXRα and 0.5 μg of rat liver nuclear extract (NE) as indicated. Pre-immune (PI) or polyclonal antiserum prepared against RXRα (RXRab) was included in the reactions. METHODS. Gel mobility shift assays were done as described for Fig. 2.