Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii

Abstract

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.

Figure 1.

Schematic drawings of the chimeric constructs and Ars expression of their corresponding transgenic lines. A, The 3′-nested deletions of a Cah1 upstream region were fused to the Ars reporter gene (Ars) driven by the β₂-tubulin minimal promoter (Pr). Asterisks represent positions of consensus sequences in the enhancer element (EEC, see text). The 63-bp enhancer region (E-region) between –293 and –231 essential for the transcriptional activation of Cah1 under low-CO₂ conditions in light is highlighted. These chimeric constructs were transformed into C. reinhardtii cells, and the Ars enzyme activity in each transformant was measured under high-CO₂ (H) and low-CO₂ (L) conditions in light. Black and white circles represent the Ars activities in independent transformants under high- and low-CO₂ conditions, respectively. Bars indicate the median values. The number of transformants used for the Ars activity measurements is represented by n. The Ars activities in transformants carrying pCT362 and pCT37 under low-CO₂ conditions were compared with those in transformants carrying pCT34 by the Mann-Whitney U test, and the resulting P values are indicated. B, Northern-blot analyses of representative strains harboring the indicated chimeric constructs using ³²P-labeled Ars- or Cah1-specific probes.

Figure 2.

Linker-scan analyses of the E-region harboring two putative enhancer elements, EE-1 and EE-2. A series of nucleotide substitutions were introduced into the E-region of the control construct pCT362. The nucleotide substitutions are indicated by lowercase letters, and nucleotides identical with the wild-type sequence are represented by dashes. The Ars activities of linker-scan constructs were measured under high-CO₂ (H) or low-CO₂ (L) conditions in light. Black and white circles represent the Ars activities in independent transformants under high- and low-CO₂ conditions, respectively. Bars indicate the median values. The number of transformants tested for the activity is represented by n. The Ars activity of each linker-scan construct under low-CO₂ conditions was compared with that of the control construct pCT362 by the Mann-Whitney U test, and the resulting P values are indicated above the graph.

Figure 3.

Gel mobility shift assay using the EE-1 probe and its derivatives. A, ³²P-labeled double-stranded oligonucleotide of EE-1 (lane 1) and linker-scan oligonucleotides (lanes 2–6) were incubated with 2.5 μg of nuclear proteins purified from cells grown under low-CO₂ conditions in light. Probes oLS1 to oLS5 carry identical nucleotide substitutions to those in constructs pLS1 to pLS5, respectively (Fig. 2). F indicates the free probe. C-I and C-II indicate the shifted bands. B, Nucleotide sequence of EE-1 and linker-scan oligonucleotides. Mutations that abolished C-I complex formation are highlighted.

Figure 4.

Gel mobility shift assay using DNA fragments of EE-1 carrying consecutive 2- or 3-bp nucleotide substitutions. A, ³²P-labeled double-stranded oligonucleotide probes of EE-1 (lane 1) and modified probes carrying consecutive 2- or 3-bp nucleotide substitutions as shown in B (lanes 2–10) were incubated with 2.5 μg of nuclear proteins purified from cells grown under low-CO₂ conditions in light. F indicates the free probe. B, Nucleotide substitutions introduced into EE-1 are shown by lowercase letters. Nucleotide substitutions that abolished C-I complex formation are highlighted. A core sequence of EE-1 critical for interaction with the DNA-binding protein is boxed.

Figure 5.

Gel mobility shift assay using DNA fragments containing four tandem copies of EE-2 (o4xEE2) and its derivatives. A, ³²P-labeled double-stranded oligonucleotide of o4xEE2 (lane 1) and modified oligonucleotides carrying linker-scan mutations (lanes 2–4) were incubated with 2.5 μg of nuclear proteins purified from cells grown under low-CO₂ conditions in light. Probes o4xLS12 to o4xLS14 carry identical mutations to those in pLS12 to pLS14, respectively (Fig. 2). F indicates the free probe. B, Nucleotide sequences of o4xEE2 and modified oligonucleotides including mutations. Mutations that abolished C-III complex formation are highlighted.

Figure 6.

Comparison of the nucleotide sequences of EE-1 and EE-2, and cross-competition assays using oEE1 and o4xEE2 probes. A, Conserved nucleotides between EE-1 and EE-2 are boxed. In oLS1 and o4xLS13, nucleotide substitutions are shown by lowercase letters. B, ³²P-labeled oEE1 (lanes 1–5) and ³²P-labeled-o4xEE2 (lanes 6–10) probes were incubated with 600-fold molar excess amounts of unlabeled competitors as indicated above. F indicates the free probe.

Figure 7.

Gel mobility shift assay using nuclear extracts purified from cells grown under high-CO₂ conditions or in the dark. Nuclear extracts were prepared from cells grown under high-CO₂ (H; lanes 2, 4, 7, and 9) or low-CO₂ (L; lanes 3, 5, 8, and 10) conditions and in the light (lanes 2, 3, 7, and 8) or the dark (lanes 4, 5, 9, and 10), and then incubated with ³²P-labeled probes, oEE1 (lanes 1–5) or o4xEE2 (lanes 6–10). F indicates the free probe.