Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2003 Dec 1;31(23):6904-15.
doi: 10.1093/nar/gkg887.

Hairpin-duplex equilibrium reflected in the A-->B transition in an undecamer quasi-palindrome present in the locus control region of the human beta-globin gene cluster

Mahima Kaushik  1 , Ritushree Kukreti, Deepak Grover, Samir K Brahmachari, Shrikant Kukreti
Affiliations

Hairpin-duplex equilibrium reflected in the A-->B transition in an undecamer quasi-palindrome present in the locus control region of the human beta-globin gene cluster

Mahima Kaushik et al. Nucleic Acids Res. .

Abstract

Our recent work on an A-->G single nucleotide polymorphism (SNP) at the quasi-palindromic sequence d(TGGGG[A/G]CCCCA) of HS4 of the human beta-globin locus control region in an Indian population showed a significant association between the G allele and the occurrence of beta-thalassemia. Using UV-thermal denaturation, gel assay, circular dichroism (CD) and nuclease digestion experiments we have demonstrated that the undecamer quasi- palindromic sequence d(TGGGGACCCCA) (HPA11) and its reported polymorphic (SNP) version d(TGG GGGCCCCA) (HPG11) exist in hairpin-duplex equilibria. The biphasic nature of the melting profiles for both the oligonucleotides persisted at low as well as high salt concentrations. The HPG11 hairpin showed a higher T(m) than HPA11. The presence of unimolecular and bimolecular species was also shown by non-denaturating gel electrophoresis experiments. The CD spectra of both oligonucleotides showed features of the A- as well as B-type conformations and, moreover, exhibited a concentration dependence. The disappearance of the 265 nm positive CD signal in an oligomer concentration-dependent manner is indicative of an A-->B transition. The results give unprecedented insight into the in vitro structure of the quasi-palindromic sequence and provide the first report in which a hairpin-duplex equilibrium has been correlated with an A-->B interconversion of DNA. The nuclease-dependent degradation suggests that HPG11 is more resistant to nuclease than HPA11. Multiple sequence alignment of the HS4 region of the beta-globin gene cluster from different organisms revealed that this quasi-palindromic stretch is unique to Homo sapiens. We propose that quasi-palindromic sequences may form stable mini- hairpins or cruciforms in the HS4 region and might play a role in regulating beta-globin gene expression by affecting the binding of transcription factors.

PubMed Disclaimer

Figures

Figure 1
Figure 1
(a) Multiple sequence alignment of the HS4 region in the β-globin gene from different organisms. (b) Transcription factor binding sites in the HS4 region.
Figure 2
Figure 2
Thermal denaturation profiles of HPA11 [d(TGGGGACCCCA), 1] and HPG11 [d(TGGGGGCCCCA), 2] at 2 µmol strand concentration of each in 20 mM sodium cacodylate buffer (pH 7.4), 100 mM NaCl and 0.1 mM EDTA.
Figure 3
Figure 3
Schematic representations of the possible structural forms adopted by (a) the quasi-palindrome d(TGGGG[G/A]CCCCA) and (b) its extended versions d(GCTCTTGGGG[G/A]CCCCAGTACA).
Figure 4
Figure 4
Thermal denaturation profiles of HPG11 sequence d(TGG GGGCCCCA) with 2 (1), 10 (2), 15 (3) and 20 µmol (4) strand concentrations in 20 mM sodium cacodylate buffer (pH 7.4), 50 mM NaCl, 0.1 mM EDTA.
Figure 5
Figure 5
Plot of oligonucleotide concentrations (µmol) versus melting temperatures (°C) for HPG11 in 20 mM sodium cacodylate buffer (pH 7.4), 50 mM NaCl, 0.1 mM EDTA.
Figure 6
Figure 6
Thermal denaturation profiles of HPG21 sequence d(GCT CTTGGGGGCCCCAGTACA) (2 µmol strand concentration) in 20 mM sodium cacodylate buffer (pH 7.4), 50 (1), 100 (2) or 500 mM (3) NaCl, 0.1mM EDTA.
Figure 7
Figure 7
10% PAGE mobility pattern of the oligonucleotide sequences. Lane 1, single-stranded heptamer control oligo [SC, d(TAAAAAT)] migrating as a single strand; lanes 2 and 3, (lower band) HPA11 and HPG11 [d(TGGGGA/GCCCCA)] migrating as a hairpin as well as (upper band) a bulge duplex; lane 4, 21mer HPG21 [d(GCTCTTGGGGGCCCCAGTACA)] migrating as a hairpin with unpaired flanking ends and (upper band) a 21mer extended bulge duplex.
Figure 8
Figure 8
CD spectra of HPA11 and HPG11 (6 µmol strand concentration) in 20 mM sodium cacodylate buffer (pH 7.4), 100 mM NaCl, 0.1 mM EDTA.
Figure 9
Figure 9
CD spectra of HPA11 at varied strand concentrations, i.e. 10, 30 and 40 µmol in 20 mM sodium cacodylate buffer (pH 7.4), 100 mM NaCl, 0.1 mM EDTA.
Figure 10
Figure 10
CD spectra of HPG11 at various strand concentrations, i.e. 10, 30, 40 and 50 µmol in 20 mM sodium cacodylate buffer (pH 7.4), 100 mM NaCl, 0.1 mM EDTA.
Figure 11
Figure 11
(a) The proposed model based on CD studies of the hairpin–duplex equilibrium, in terms of the A-type→B-type transition. (b) Schematic presentation of the oligonucleotide structures used in S1 nuclease digestion experiments.
Figure 12
Figure 12
Time course of degradation of HPG11, HPA11, HPNC, HPG21 and OLIGO2 caused by nuclease S1 as monitored by the increase in absorbance at 260 nm.
See this image and copyright information in PMC

References

    1. Sinden R.R. (1994) DNA Structure and Function. Academic Press, New York, NY.
    1. Saenger W. (1984) Principles of Nucleic Acid Structure. Springer-Verlag, New York, NY.
    1. Brahmachari S.K., Meera,G., Sarkar,P.S., Balagurumoorthy,P., Tripathi,J., Raghavan,S., Shaligram,U. and Pataskar,S. (1995) Simple repetitive sequences in the genome: structure and functional significance. Electrophoresis, 16, 1705–1714. - PubMed
    1. Weber I.T., McKay,D.B. and Steitz,T.A. (1982) Two helix DNA binding motif of CAP found in lac repressor and gal repressor. Nucleic Acids Res., 10, 5085–5101. - PMC - PubMed
    1. Kim J.L., Nikolov,D.B. and Burley,S.K. (1993) Co-crystal structure of TBP recognizing the minor groove of TATA element. Nature, 365, 520–527. - PubMed

MeSH terms