Molecular and diagnostic clinical virology in real time

Abstract

During the last decade, the application of both qualitative and quantitative nucleic acid detection techniques has had a major impact on diagnostics in clinical virology. Both signal and target amplification-based systems are currently used routinely in most if not all virology laboratories. However, commercial assays are only available for a very limited number of targets, and this has resulted in the development and introduction of assays developed in-house for most viral targets. With improved and automated nucleic acid sample isolation techniques, as well as real-time detection methods, a new generation of assays for most clinically important viruses is being developed. These technological improvements also make it possible to generate results with a very short turnaround time. As an example of a more individual-patient disease-management concept, we have introduced in our clinical setting the quantitative detection of Epstein-Barr virus (EBV) in T-cell-depleted allogeneic stem cell transplant patients. This has enabled us to develop models for pre-emptive anti-B-cell immunotherapy for EBV reactivation, and for reducing not only the incidence of EBV lymphoproliferative disease (EBV-LPD), but the virus-related mortality. It is now also feasible to introduce molecular testing for those viruses that can easily be detected using classical virological methods, such as culture techniques or antigen detection. Prospective studies are needed to evaluate the clinical importance of the additional positive samples detected. It should, however, be clear that a complete exchange of technology is unlikely to occur, and that complementary methods should stay operational, making possible the discovery of new viruses. Furthermore, the ability to characterise viruses more easily by sequencing opens new possibilities for epidemiological studies. There is also an urgent need, with regard to molecular diagnostic methods, for the introduction and use of standardised materials and participation in international quality control programmes. Finally, with the introduction of a universal internal control throughout the whole procedure, the accuracy of the results generated is warranted.

Figure 1

Data with the C _t value of the amplification plot of seal herpes virus type 1 (PhHV‐1) added at a fixed concentration of approximately 5000–8000 copies/mL to each clinical sample. The results of a single experiment are shown, imported into a spreadsheet. The virus was coextracted using the MagnaPure LC isolation station, and quantified on an ABI7700 sequence detection system, using TaqMan universal reaction mixture (Applied Biosystems, Nieuwerkerk aan de Ijssel, The Netherlands). Primers and probe sequence were: forward primer 5′‐GGGCGAATCACAGATTGAATC, reverse primer 5′‐GCGGTTCCAAACGTACCAA, probe (labelled with TET) 5′‐TTTTTATGTGTCCGCCACCATCTGGATC. An amplification product of 89 bp within the gB gene is generated. The average C _t value was 30.68 (average from 2359 samples analysed with this lot number), with an SD of 0.9. Samples in which the C _t value for the internal control was > 32.5 (average plus 2 SD) had to be repeated (one in this run, see arrow).

Figure 2

Pre‐emptive (PE) anti‐B‐cell immunotherapy for EBV. To monitor patients at risk for EBV PTLD, EBV DNA load was measured on a regular basis. At a level of 1000 copies/mL, the patients were recalled to the hospital, and PE therapy with rituximab (anti‐CD20 therapy) was initiated. Monitoring was performed five times a week, until the EBV DNA level was twice below the limit of detection of the assay (50 copies/mL). If the signal did not decrease rapidly (or an increase was observed), a second infusion of rituximab or an infusion of donor lymphocytes (DLI) was given (see data represented by a thick line). The initiation of PE therapy is represented as day 0. Each line represents an individual patient.