Novel insertion and deletion mutations in the 5'-UTR of the folate receptor-alpha gene: an additional contributor to hyperhomocysteinemia?

Abstract

Objectives: To search for mutations in the 5'-UTR and proximal promoter region of the folate receptor-alpha (FR-alpha) gene, whose exons are known to be virtually free of genetic variation in the population.

Design and method: Seven hundred seventy-eight patient samples were screened for mutations between nt -116 and nt +207 in the FR-alpha gene using single strand conformation polymorphism (SSCP) followed by DNA sequencing.

Results: Three patients were found to have a 25-bp deletion, c.109_133delCCACTAAACCACAGCTGTCCCCTGG, and three others had a 1-bp A insertion, c.-69dupA, so that 0.77% of the patient population showed genetic variation already in the 323 bp promoter sequence studied so far.

Conclusions: The promoter region of FR-alpha may harbor much more genetic variation than its highly conserved exons, and not just isolated, unique mutations. This could be a new factor contributing to gene-food interaction explaining part of the hyperhomocysteinemia panorama. Extended searches for polymorphisms further upstream in the FR-alpha gene are warranted.