FRIGIDA-related genes are required for the winter-annual habit in Arabidopsis

Abstract

In temperate climates, the prolonged cold temperature of winter serves as a seasonal landmark for winter-annual and biennial plants. In these plants, flowering is blocked before winter. In Arabidopsis thaliana, natural variation in the FRIGIDA (FRI) gene is a major determinate of the rapid-cycling vs. winter-annual flowering habits. In winter-annual accessions of Arabidopsis, FRI activity blocks flowering through the up-regulation of the floral inhibitor FLOWERING LOCUS C (FLC). Most rapid-flowering accessions, in contrast, contain null alleles of FRI. By performing a mutant screen in a winter-annual strain, we have identified a locus, FRIGIDA LIKE 1 (FRL1), that is specifically required for the up-regulation of FLC by FRI. Cloning of FRL1 revealed a gene with a predicted protein sequence that is 23% identical to FRI. Despite sequence similarity, FRI and FRL1 do not have redundant functions. FRI and FRL1 belong to a seven-member gene family in Arabidopsis, and FRI, FRL1, and at least one additional family member, FRIGIDA LIKE 2 (FRL2), are in a clade of this family that is required for the winter-annual habit in Arabidopsis.

Fig. 1.

Effect of FRL1 on flowering time and FLC expression. (A) Total leaves formed by the primary meristem of plants grown under long (black bars) or short days (gray bars). The shaded and open portions of the bars indicate the number of rosette leaves and cauline leaves. Error bars indicate one standard deviation. (B) RNA-blot analysis of FLC expression in the frl1-1 mutant, Col (fri; FRL1) and the parental FRI-SF2 in the Col line (FRI; FRL1). RNA was isolated from 14-day-old seedlings grown under continuous light. Blots were also probed with 18S rDNA as a control for loading.

Fig. 2.

Phenotype of FRL1 in various late-flowering backgrounds. (A) Flowering time of frl1-1 in fri, autonomous-pathway (ld and fpa), and photoperiod-pathway (gi) mutant backgrounds. Flowering time is expressed as total leaves formed by the primary meristem. The shaded and open portions of the bars indicate the number of rosette leaves and cauline leaves. Error bars indicate one standard deviation. (B) Semiquantitative RT-PCR analysis of flowering time genes in fri, frl1, and ld mutant backgrounds and after vernalization. RNA was isolated from 14-day-old seedlings grown under continuous light. For vernalization treatments, imbibed seeds were incubated for 40 days at 2°C followed by 14 days at 22°C.

Fig. 3.

Sequence analysis of FRL1 and related proteins. (A) Schematic representation of the FRL1 locus with the sites of lesions indicated. frl1-2 contains a 40-nt deletion (CTGTTGATACGAGAAATAGAGCTAAGAAACTGGCTTACCA) and frl1-3 contains a 4-nt deletion (GTGTTTCTGCATTTGGTCGCAGCTTTTGAA, deleted bases are underlined). (B) Locations of FRL1-related genes in the Arabidopsis genome. Synteny was detected only between the At1g14900 and At2g22440 loci. (C) Neighbor-joining tree for FRL1-related proteins from Arabidopsis and rice (rice sequences are italicized). The tree is rooted at the midpoint. Bootstrap values are shown as percent support. The tree was created with macvector 7.2 (Accelrys, Cambridge, U.K.). Gene structures are shown with introns indicated in gray. Asterisks indicate genes for which full-length cDNA (Arabidopsis) or unigene (rice) sequences are available. (D) clustal alignment of FRL1 and FRI.

Fig. 4.

Effects of overexpression of FRL1 and FRI. (A) Flowering time of transgenic lines containing 35S::FRL1 or 35S::FRI in frl1 and fri-mutant backgrounds and after vernalization. All lines are in the Col genetic background. Data are presented for two independent transgenic lines in each background. Flowering time is expressed as total leaves formed by the primary meristem. The shaded and open portions of the bars indicate the number of rosette and cauline leaves. Error bars indicate one standard deviation. (B) A model for the regulation of flowering by FRL1 and FRL2.