-1 frameshifting at a CGA AAG hexanucleotide site is required for transposition of insertion sequence IS1222

Abstract

The discovery of programmed -1 frameshifting at the hexanucleotide shift site CGA_AAG, in addition to the classical X_XXY_YYZ heptanucleotide shift sequences, prompted a search for instances among eubacterial insertion sequence elements. IS1222 has a CGA_AAG shift site. A genetic analysis revealed that frameshifting at this site is required for transposition.

FIG. 1.

Functional analysis of the IS1222 frameshift region. (A) Signals and predicted branched stem-loop structure in the IS1222 frameshift region. (B) The IS1222 frameshift region shown in panel A was cloned into plasmids pOFX302 (14) and pGHM (i.e., the GM1 derivative with a C-terminal His tag and a PreScission protease site described previously [6]), by using the indicated restriction sites. In the pOFX302 construct, normal translation of gene 10 should end at the indicated UGA stop codon in the cloned IS1222 region to give a 274-amino-acid product (NT). Frameshifting on CGA_AAG should lead to synthesis of a 1,325-amino-acid protein (FS). Independent initiation at the GUG codon in the IS1222 orfB frame should give a 1,041-amino-acid product (IN). (C) Translation products from the plasmid-borne gene 10-lacZ region were detected by in vivo [³⁵S]methionine pulse-labeling polyacryamide gel electrophoresis and quantitated with a Fuji PhosphoImager (2, 14). The frameshifting and initiation capacities of the IS1222 recoding region (lane 4) were estimated by comparison with reference strains (lanes 1 to 3). Lane 1 corresponds to the labeling of the vector-containing strain used for background correction. Lanes 2 and 3 respectively correspond to constructs expressing at the maximum level the LacZ (100% IN) and G10-LacZ (100% FS) products (plasmids pOFX302-0 and pOFX302-4, described in reference 14). (D) Mass spectrum of a proteolytic fragment (FS*) from the frameshift product purified from a strain containing the IS1222 region cloned into plasmid pGMH. The 73-kDa frameshift product was purified, digested with PreScission protease (Amersham), and analyzed as previously described (6). The observed mass of the FS* product (46,658 Da) is exactly that expected for the proteolytic fragment derived from a Gst-MalE fusion protein generated through −1 frameshifting, from AAG to the overlapping AAA codon, on the CGA_AAG motif.

FIG. 2.

Genetic analysis of the IS1222 stimulatory stem-loop. (A) Deletion of the 3′ half of the structure. (B) Deletion of the region 3′ of the stem-loop removing the putative pseudoknot. (C) Set of three mutants in which stability of the bottom stem is either altered or restored. All mutants were generated by cloning oligonucleotides into plasmid pOFX302 and subsequent pulse-labeling analysis (2, 14).

FIG. 3.

Transposition activity in E. coli of a frameshift-proficient and a frameshift-deficient IS1222 variant. An active IS1222 variant was amplified from the genome of a clinical isolate of R. aquatilis and cloned into the EcoRI and SphI sites of plasmid pAT153, to give pAT::IS1222wt. Two oligonucleotides (I-L and I-R), corresponding to the left and right ends of the IS as previously published (accession number X78052) (16), were used for amplification. The frameshift motif was then changed to CGC_AAA, to prevent frameshifting, by using PCR mutagenesis and the plasmid EcoRI site and the IS ScaI site overlapping the CGA_AAG motif, thus giving plasmid pAT::IS1222mut (experimental details available upon request). Plasmid DNA was prepared from strains containing either pAT153 or its two IS-containing derivatives, linearized with PstI, and tested in PCRs containing two divergent IS oligonucleotides (O-L, ACCTCCATACCGCCATACTTCTTACGCCA, and O-R, TATCCGGCGACAATAAGAACCGATCAG). Authenticity of the 531-bp fragment obtained with pAT::IS1222wt was verified by sequencing.