A molecular link between SR protein dephosphorylation and mRNA export

Abstract

In metazoans, multiple RNA-binding proteins, including the shuttling serine/arginine-rich (SR)-splicing factors, function as adapters for mRNA nuclear export by interacting with the export receptor TAP/nuclear export factor 1 (NXF1). Yet, it is unclear how interactions between adapters and TAP are regulated. Here, we demonstrate that the SR proteins 9G8 and ASF/SF2 exhibit higher affinity for TAP/NXF1 when hypophosphorylated. 9G8 is recruited to the pre-mRNA in a hyperphosphorylated form but becomes hypophosphorylated during splicing both in vivo and in vitro. TAP preferentially binds spliced mRNA-protein complexes compared with pre-mRNA-protein complexes. Thus, the phosphorylation state of the SR protein adapters may underlie the selectivity of TAP-mediated export of spliced mRNA.

Fig. 1.

TAP preferentially binds hypophosphorylated 9G8 and ASF/SF2. (A) Schematic of the domain structures of TAP (2, 29) and the recombinant proteins used in the binding assays. (B) TAP binding to 9G8 and ASF/SF2 in vitro. Bacterially expressed and affinity-purified GST-TAP231 (lane 5) or GST alone (lane 4) prebound on glutathione beads was incubated with HeLa cell nuclear extract. Bound (Pellet) fractions were resolved by 10% SDS/PAGE, followed by Western blot analysis by using anti-9G8 (Upper) or anti-ASF/SF2 (Lower) antibodies. Parallel extract samples not treated (None, lane 1), treated with alkaline phosphatase plus phosphatase inhibitors (AP + Inh, lane 2), or treated with AP (AP, lane 3) indicate the positions of differentially phosphorylated forms of 9G8 (Upper) and ASF/SF2 (Lower). (C) TAP binding to 9G8 and ASF/SF2 in vivo. HEK293 cells were transiently transfected with plasmids pcDNA-Flag-TAP expressing a Flag-tagged full-length TAP or pcDNA-Flag alone. The Flag-TAP or Flag was immunoprecipitated from the transfected cell extracts with anti-Flag antibodies. Five percent of the supernatants (Sup, lanes 1 and 2) and the precipitated proteins (Pellet, lanes 3 and 4) were analyzed by Western blotting by using anti-9G8 (Top), anti-ASF/SF2 (Middle), or anti-SC35 (Bottom) antibodies.

Fig. 2.

9G8 is hypophosphorylated in spliced mRNPs in vivo.(A) Agarose gels showing the RT-PCR products of endogenous β-actin RNA (20) in RNPs immunoprecipitated by anti-hnRNP A1 antibodies (lanes 1–6) or by a control mouse IgG (lanes 7–12) from the cytoplasmic (C), NS, and NI fractions. In the odd lanes, a set of primers corresponding to the second intron and the third exon of the human β-actin gene, respectively, was used for the pre-mRNA. In the even lanes, a set of primers corresponding to the second and the fifth exons of the gene, respectively, was used for the spliced mRNA. (B and C) Results of representative Western blot analyses of 9G8 in RNPs immunoprecipitated by anti-hnRNP A1 antibody (B, lanes 1–3) or control mouse IgG (C, lanes 1–3) from the indicated fractions. One percent of the corresponding supernatants were analyzed on the right. The efficiency of hnRNP A1 precipitation was 10% (data not shown). (D) TAP preferentially associates with spliced mRNP in vivo. HeLa cells were transiently transfected with plasmids pcDNA-Flag-TAP expressing Flag-TAP or pcDNA-Flag alone. RNPs from the transfected cell lysates were isolated by using anti-Flag antibody. RT-PCR products of RNAs extracted from the purified RNPs (Pellet, lanes 5–8) and from 2% of the supernatants (Sup, lanes 1–4) were resolved on 1% agarose gels. Primers for PCR were as in A.

Fig. 3.

TAP-mRNP association and splicing-dependent 9G8 hypophosphorylation in vitro. (A) TAP binds spliced mRNP after splicing in vitro. ³²P-labeled adenovirus splicing substrate (AdML) (19) (Input) was incubated with HeLa nuclear extract under splicing conditions. Glutathione beads precoated with GST-TAP231 or GST alone were added to the total reaction (lanes 3–6) or to a proteinase K-treated reaction (lanes 9–12). Radioactive RNAs selected by the bead-bound proteins (P, lanes 4, 6, 10, and 12) or from 5% (S, lanes 3 and 5) or 20% of the corresponding supernatants (lanes 9 and 11) were resolved on 8% denaturing polyacrylamide gels and visualized by PhosphorImager. Total, 5% of the splicing reaction before the binding assays. The bands marked * in this panel and in the following panels were nonspecific degradation products. (B) Adenovirus splicing substrate (lane 1) was incubated under splicing conditions in HeLa nuclear extract deficient in splicing activity (lane 2). Splicing was stimulated in a dose-dependent manner by addition of 9G8 made by in vitro translation (lanes 3 and 4). (C) In vitro splicing was performed with in vitro translated ³⁵S-labeled 9G8 and unlabeled splicing substrate. Quantitations (Upper) were the average of two independent experiments, where the observed ratios differed by no more than 15%. Splicing reactions were in the absence (lane 1) or presence (lanes 3–5) of the splicing substrate and with the addition of the U6-5′SS oligonucleotide (CUCUGUAUCGUUCCAAUUUU, lane 3), a control (Contr) oligonucleotide (UUUCCAGUAGCUGAA, lane 4), or no oligonucleotide (lane 5). Three microliters of rabbit reticulocyte lysate containing the ³⁵S-labeled 9G8 used were loaded in lane 2. (D) A splicing reaction comparable to C contained an equivalent amount of in vitro translated but unlabeled 9G8 whereas the splicing substrate was ³²P-labeled. The identities of the spliced products are marked on the right in A, B, and D.

Fig. 4.

A model for the role of SR protein dephosphorylation in mRNA export. Hyperphosphorylated SR proteins are recruited to pre-mRNA molecules at exonic enhancers (15). During splicing, SR proteins are hypophosphorylated but remain associated with the spliced mRNP. Together with the exon junction complex (EJC), which contains REF1 (ref. and references therein), they recruit multiple copies of TAP, thereby increasing the efficiency of export of spliced versus unspliced mRNP. In the cytoplasm, rephosphorylation of the SR protein adapters results in their dissociation from mRNP complexes and in their recycling to the nucleus.