Substrate specificities of bacterial and human AlkB proteins

Abstract

Methylating agents introduce cytotoxic 1-methyladenine (1-meA) and 3-methylcytosine (3-meC) residues into nucleic acids, and it was recently demonstrated that the Escherichia coli AlkB protein and two human homologues, hABH2 and hABH3, can remove these lesions from DNA by oxidative demethylation. Moreover, AlkB and hABH3 were also found to remove 1-meA and 3-meC from RNA, suggesting that cellular RNA repair can occur. We have here studied the preference of AlkB, hABH2 and hABH3 for single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA), and show that AlkB and hABH3 prefer ssDNA, while hABH2 prefers dsDNA. This was consistently observed with three different oligonucleotide substrates, implying that the specificity for single-stranded versus double-stranded DNA is sequence independent. The dsDNA preference of hABH2 was observed only in the presence of magnesium. The activity of the enzymes on single-stranded RNA (ssRNA), double-stranded RNA (dsRNA) and DNA/RNA hybrids was also investigated, and the results generally confirm the notion that while AlkB and hABH3 tend to prefer single-stranded nucleic acids, hABH2 is more active on double-stranded substrates. These results may contribute to identifying the main substrates of bacterial and human AlkB proteins in vivo.

Figure 1

Activity of human and bacterial AlkB proteins on single-stranded and double-stranded DNA substrates. [³H]methylated DNA oligonucleotides were incubated with varying amounts of AlkB (A, D and G), hABH2 (B, E and H) or hABH3 (C, F and I), and the ethanol soluble radioactivity released was measured by scintillation counting. The [³H]methylated substrates used were AT-oligo (A–C) TAAAATAATAAATTAAA; AGC-oligo (D–F) AAAGCAAGAAACGAAAAAGCGAAA; AGCT-oligo (G–I) CATGATAACCGCGACTACACTGAC. Closed symbols indicate single-stranded [³H]methylated DNA oligonucleotides, while open symbols indicate the corresponding double-stranded substrates, generated by association with the unmethylated complementary strand. Error bars represent the range of duplicate measurements.

Figure 2

Preference of hABH2 for double-stranded DNA in the presence of magnesium. Single-stranded (closed symbols) or double-stranded (open symbols) [³H]methylated ACGT-oligo was incubated with varying amounts of hABH2 in the absence (circles) or presence (triangles) of 10 mM MgCl₂, and the ethanol soluble radioactivity was measured by scintillation counting.

Figure 3

Activity of AlkB proteins on a [³H]methylated DNA oligonucleotide associated with a complementary RNA strand. Increasing concentrations of AlkB (A), hABH2 (B) or hABH3 (C) were incubated with [³H]methylated ACGT-oligo (ssDNA, closed symbols), or with the same oligo associated with a complementary RNA strand (DNA*:RNA, open symbols). The liberated ethanol soluble activity was measured by scintillation counting. Error bars represent the range of duplicate measurements.

Figure 4

Repair of [³H]methylated RNA oligonucleotides by AlkB and hABH3. Increasing amounts of AlkB (A) or hABH3 (B) were incubated with a [³H]methylated RNA oligonucleotide (ssRNA, closed circles), or with the same oligonucleotide annealed to a complementary DNA strand (RNA*:DNA, open circles) or RNA strand (dsRNA, triangles). The sequence of the [³H]methylated RNA oligonucleotide was CAUGAUAACCGCGACUACACUGAC (corresponding to the DNA sequence of the ACGT-oligo used previously). Error bars represent the range of duplicate measurements.