Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences

Abstract

Large DNA constructs of arbitrary sequences can currently be assembled with relative ease by joining short synthetic oligodeoxynucleotides (oligonucleotides). The ability to mass produce these synthetic genes readily will have a significant impact on research in biology and medicine. Presently, high-throughput gene synthesis is unlikely, due to the limits of oligonucleotide synthesis. We describe a microfluidic PicoArray method for the simultaneous synthesis and purification of oligonucleotides that are designed for multiplex gene synthesis. Given the demand for highly pure oligonucleotides in gene synthesis processes, we used a model to improve key reaction steps in DNA synthesis. The oligonucleotides obtained were successfully used in ligation under thermal cycling conditions to generate DNA constructs of several hundreds of base pairs. Protein expression using the gene thus synthesized was demonstrated. We used a DNA assembly strategy, i.e. ligation followed by fusion PCR, and achieved effective assembling of up to 10 kb DNA constructs. These results illustrate the potential of microfluidics-based ultra-fast oligonucleotide parallel synthesis as an enabling tool for modern synthetic biology applications, such as the construction of genome-scale molecular clones and cell-free large scale protein expression.

Figure 1

(A) Schematic illustration of a PicoArray reactor for parallel synthesis of oligonucleotides. A two-layered structure consisting of annealed silicon and glass, isolated reaction chambers etched on silicon and aligned in parallel, and inlet and outlet solution distribution channels that are connected through reaction chambers. The digital light projection is shown at selected sites to allow the PGA-controlled reaction to occur only in light-irradiated reaction chambers. (B) Pseudo-color image of the hybridization of the oligonucleotides that were PCR amplified from the PicoArray synthesized oligos to a detection chip. The 1011 detection probes captured either sense (red) or antisense (green) strands in a chessboard pattern. The sequences were 21–22mer, corresponding to the variable region of the target oligonucleotides. All spots have intensities above the background with spot-to-spot CV being <10%. The binding specificities are shown by the clearly defined red and green chessboard spots and the differential binding of the perfect match versus the deletion sequences (spots in the green image on right). These comparisons should be made for each set of three spots of the same column as labeled, which are of the same sequence other than the one or two base deletion sites contained in the deletion sequences. An example of the sequences of comparison sequences include: d(AACACATTAGACGGCCTCCTGC), d(AACACATTA_ACGGCCTCCTGC) with one deletion represented by ‘_’, and d(AACACAT_AGACG_CCTCCTGC) with two deletions.

Figure 2

The predicted product distributions of oligodeoxynucleotide synthesis by modeling. The length of the oligomers is given as the x-axis. (A) In a case of high yield synthesis, the full-length 40mer sequence is 67.0% (40-cycle synthesis) and the (n − 1)mer (39mer accumulated from the various failure steps) over nmer (the full-length sequence) is 0.20. (B) A reaction with a lower coupling efficiency would result in a low yield of full-length product (24.2%) as compared to 67.0% in (A), but this would only marginally increase n − 1:n ratio of sequences from 0.20 to 0.21. The majority of the failure products are capped as short fragments. (C) The same reaction efficiencies as in (B) but without using capping. This results in a poor product distribution; n − 1:n ratio is 1.41, which is significantly higher than 0.21 shown in (B) for synthesis using the capping step. (D) A reaction with a low deprotection (or deblock) efficiency of 97.0% but high coupling and capping efficiencies would still produce a poor product distribution having a high n − 1:n ratio of 1.24. (E) The same reaction as in (D) but for a 16mer synthesis. The full-length sequence is 24.2%. (F) In a dramatic case of poor deprotection, no full-length sequence can be produced and the impurity products show characteristic binominal distribution patterns.

Figure 3

Plots of CE of oligonucleotides synthesized on a PicoArray reactor using PGA. (A) CE plot of a 31mer oligonucleotide synthesized as a case of poor deprotection efficiency (see DNA synthesis modeling, Figure 2F). (B) CE plot of a 31mer oligonucleotide synthesized after reaction optimization and high yield synthesis (98.8%) was achieved using the microfluidic PicoArray reactor.

Figure 4

(A) Electrophoresis gel of EGFP gene (714 bp) synthesized using ligation, followed by PCR amplification using primers for the 714 bp region. Labels 0.05, 0.20, and 0.75 are fractions of the oligonucleotides used for ligation reactions based on the material collected from the PicoArray synthesis. In each set, lane 1 used Pfu DNA polymerase, lane 2 used Taq (SureStart), lane 3 used a different set of primers from lane 1 and Pfu. Control lanes used oligonucleotides synthesized on CPG. M represents the 1 kb molecular marker. (B and C) Displays of the EGFP protein expressed from genes assembled using (B) oligonucleotides (synthesized on CPG) from a commercial source or (C) oligonucleotides synthesized and recovered from the PicoArray reactor. The number of the functional colonies in (A) is 26.8% (19 out of 71) and in (B) is 30.0% (40 out of 132), excluding two positive and two negative controls. (D) Illustration of the overall DNA synthesis strategy, i.e. ligation of oligonucleotides into fragments of several hundreds of base pairs followed by fusion PCR, used in this work.

Scheme 1. Analysis of the product distribution of oligonucleotide systems.