The ubiquitin-proteasome system facilitates the transfer of murine coronavirus from endosome to cytoplasm during virus entry

Abstract

The ubiquitin-proteasome system is involved in cellular endocytosis and maturation of some viruses. In this study, we found that proteasome inhibitors blocked mouse hepatitis virus replication at an early step in the viral life cycle. In the presence of MG132, the entering viruses accumulated in both the endosome and denser lysosome, suggesting that the ubiquitin-proteasome system is involved in the release of virus from the endosome to the cytosol during the virus entry step.

FIG. 1.

The proteasome inhibitors lactacystin and MG132 blocked MHV(JHM) replication. (A) Cytotoxicity of lactacystin and MG132. DBT cells were treated with 5 μM lactacystin (Biomol, Plymouth, Pa.) or 5 μM MG132 (Biomol) or with the same volume of dimethyl sulfoxide (DMSO) (vehicle control) for 16 h and analyzed by CytoTox-One Homogeneous Membrane Integrity assay (Promega, Madison, Wis.). (B, C) Detection of virus production and viral protein synthesis for cells treated with a proteasome inhibitor. DBT cells, a mouse astrocytoma cell line (10), were pretreated with lactacystin (5 μM), MG132 (5 μM), or DMSO for 2 h, infected with MHV(JHM) (multiplicity of infection of 0.1) for 1 h, and then incubated at 37°C for different lengths of time in the presence or absence of the proteasome inhibitors. (B) Virus titers in the culture medium were determined by plaque assay (1). Standard variations were calculated from three replicate samples of each treatment. 1.00E+00, 1 × 10⁰. (C) The infected cells were also collected for detection of viral N protein by Western blotting using monoclonal antibody J3.3 (3). β-Actin was used as an internal control.

FIG. 2.

Kinetics of virus replication after pulse treatment with MG132. (A) Experimental design for pulse treatment with MG132. The cells were treated with MG132 during different time windows. Culture medium was collected, and fresh medium was replenished at 6-h intervals. (B) The virus titer at each time point was detected by a plaque assay. Standard variations were calculated from three replicate samples of each treatment. 1.00E+00, 1 × 10⁰.

FIG. 3.

(A) Effect of MG132 on virus internalization. Virus internalization assay was performed as described previously (1). DBT cells preincubated for 2 h with or without MG132 were incubated with MHV(JHM) at 4°C for 1 h (multiplicity of infection [MOI] of 0.1). After cells were washed with medium, they were either maintained at 4°C or shifted to 37°C for one more hour for virus internalization. Afterwards, infected cells were treated with proteinase K (50 μg/ml) to remove noninternalized viruses. The treated cells were diluted in serial 10-fold dilutions with untreated DBT cells and plated onto a six-well plate. Five hours later, the medium was removed, and the plates were overlaid with agar as in the plaque assay. After 48-h incubation, plaques were counted after neutral red staining. (B) Endosome purification by flotation gradient. DBT cells were treated with MG132 for 2 h, infected with MHV(JHM) for 1 h (MOI of 0.1), and incubated at 37°C for three more hours in the presence or absence of MG132. The infected cells were collected and examined by a sucrose flotation assay (6). Cells were lysed in 0.5 ml of homogenization buffer (250 mM sucrose, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF]) by passage through a 22-gauge needle 10 times. The supernatant (postnuclear supernatant [PNS]) was collected after centrifugation (1,000 × g) and was adjusted to a concentration of 40.6% sucrose and 1 mM EDTA. One milliliter of PNS in 40.6% sucrose was transferred to the bottom of an SW55Ti tube and overlaid sequentially with 2 ml of 35% sucrose, 1.5 ml of 25% sucrose, and 1 ml of homogenization buffer. After centrifugation (100,000 × g, 4°C, 1 h), samples were collected from the top to the bottom in 1-ml fractions. The fraction numbers are shown above the gel. Total RNA was extracted from each fraction by using TRI REAGENT-LS (Molecular Research Center, Cincinnati, Ohio), and viral RNA was detected by RT-PCR using primers 5′TATAAACGGCACTTCCTGCG3′ (forward) and 5′AACCCATCCTCCTCTGACCT3′ (reverse) [the 5′ untranslated region of MHV(JHM) RNA]. An aliquot of PNS before sucrose gradient sedimentation was used to quantitate the total amount of viral RNA in the treated and untreated cells (right gel). (C) Various organelle markers, including Rab5 (early endosome marker; Stressgen Biotechnologies Corporation, Victoria, British Columbia, Canada), Grp78 (ER marker, anti-KDEL antibody; Stressgen), and β-actin (cytosol marker) were detected by Western blotting.

FIG. 4.

Detection of viruses in the dense lysosome fractions. DBT cells were treated with or without MG132 as described in the legend to Fig. 3 and harvested for Percoll gradient centrifugation (2). Cells were lysed in 2 ml of homogenization buffer (250 mM sucrose, 1 mM EDTA, 1 mM PMSF) by passage through a 22-gauge needle seven times. After centrifugation at 1,000 × g for 10 min, the postnuclear supernatant was collected and put on top of a 27% Percoll gradient (1-ml cushion of 2.5 M sucrose at the bottom and 9 ml of 27% Percoll solution in 250 mM sucrose-1 mM EDTA), and the gradient was spun at 34,000 × g (SW41) at 4°C for 1 h. Samples were collected at 1 ml/fraction from the bottom to the top. The fraction numbers are shown above the gel. (A) Viral RNA of each fraction was detected by RT-PCR. (B) Acid phosphatase activity analyzed by using an acid phosphatase kit (Sigma, Saint Louis, Mo.). Acid phosphatase activity served as a lysosome marker. Other organelle markers (Grp78 and β-actin) were detected by Western blotting. (C) RNase sensitivity assay. Fractionated samples (fractions 9, 10, and 11) from Percoll gradient were treated with RNase A (1 μg/ml) or not treated with RNase A, and viral RNA was detected by RT-PCR of the 5′ untranslated region. RNA samples from fractions 10 and 11 that were diluted 100-fold for the RT reaction are indicated by asterisks.