Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins

Abstract

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Figure 1. In vitro decay of SERCA2b 3′-region fragments

(A) Scheme showing SERCA2b mRNA and the overlapping fragments 2B1–2B6. Numbers along the lines are sequence locations. (B) Representative PhosphorImages of gels with RNA fragments after in vitro decay of 5 ng/20 μl of RNA by 25 μg/20 μl of protein from nuclear extracts. (C) Means±S.E.M. of decay constants for SERCA2b fragments 2B1–2B6 and G3PDH in three to five experiments each.

Figure 2. Electrophoretic mobility-shift assays with SERCA2b fragments and protein extract from LVM nuclei

(A) Protein-concentration-dependence. Radiolabelled RNA (5 ng/20 μl) was used with protein concentrations (μg/20 μl) given along each lane. The lower arrow indicates the location of the band without any proteins, and the two higher arrows show the mobility-shifted RNA. (B) and (C) Competition of various unlabelled RNA fragments with radiolabelled 2B1 (5 ng/20 μl) for mobility shift by protein from LVM nuclear extracts (2 μg/20 μl). R, radiolabelled RNA alone; RP, radiolabelled RNA+protein, but no unlabelled RNA. Protein was included in all the lanes with radiolabelled RNA plus different amounts of unlabelled RNA (ng/20 μl, shown with each panel). Arrows indicate the position of the radiolabelled RNA in the absence or the presence of the proteins from the nuclear extracts. (D) G3PDH RNA. R, radiolabelled RNA alone; RP, radiolabelled RNA+protein (1 μg/20 μl).

Figure 3. Competitive mobility shift of 2B1 with smaller fragments

(A) Competition of 35-base RNA fragments with radiolabelled 2B1 (5 ng/20 μl) for mobility shift by protein from LVM nuclear extracts (2 ng/20 μl). R, radiolabelled RNA alone; RP, radiolabelled RNA+protein, but no unlabelled RNA. Protein was included in all the lanes with the radiolabelled RNA plus 5 or 500 ng/20 μl of unlabelled RNA. The identities of the 2B1-1 to 2B1-12 RNA fragment are given as numbers 1–12 at the bottom of the panels. Unlabelled 2B1 RNA (5 or 100 ng/20 μl) was used as a positive control for the competition. The experiment was replicated three times. (B) Summary of results from (A) and other competition experiments using radiolabelled smaller RNA fragments to compete with binding to radiolabelled 2B1 RNA. Yes indicates that the RNA competed for the binding and No indicates that it did not. The approximate location of each base is shown schematically, and the base numbers correspond to the full-length SERCA2b sequence. Arrows indicate the position of the radiolabelled RNA in the absence or the presence of the proteins from the nuclear extracts.

Figure 4. Competitive mobility shift and UV cross-linking of 35-base fragment 4 with different RNA

(A) Competition of different RNA (500 ng/20 μl) with radiolabelled fragment 4 (5 ng/20 μl) for mobility shift by protein from LVM nuclear extracts (2 μg/20 μl). R, radiolabelled RNA alone; RP, radiolabelled RNA+protein, but no unlabelled RNA. Protein was included in all the lanes with unlabelled RNA. The amount of unlabelled RNA was 500 ng/20 μl. The identities of the RNA fragment, given as numbers B1-3, B1-4, B1-5 and B1-4S, are as in Figure 3(B). Unlabelled 2B1 RNA (5 or 100 ng/20 μl) was used as a positive control. Arrows indicate the position of the radiolabelled RNA in the absence or the presence of the proteins from the nuclear extracts. (B). UV cross-linking of radiolabelled fragment 4 (2 ng/20 μl) with proteins (8 μg/20 μl) from LVM nuclear extracts. R, radiolabelled RNA alone; RP, radiolabelled RNA+protein alone. Competition with specified unlabelled RNA fragments (2.5 μg/20 μl) is shown in the right-hand three lanes.

Figure 5. Effect of 2B1-4 RNA on in vitro decay of 2B1 RNA

In vitro decay of capped and poly(A⁺) radiolabelled 2B1 RNA (2.5 ng/20 μl) was examined in the presence of LVM nuclear protein extract (10 μg/20 μl) without any added unlabelled RNA, or with (500 ng/20 μl) 2B1-3 and 2B1-4 RNA (RNA domains are defined in Figure 3B). The experiment was carried out with three to four replicates. (A) PhosphorImages of triplicate gels. (B) Histogram showing means±S.E.M. of relative intensities of the bands, taking the mean intensity at 0 min as 100%. Asterisks (*) indicate that the relative intensity differed significantly from the control without any added unlabelled RNA. The entire experiment was replicated three times.

Figure 6. In vitro decay of 2B1-del 4 and 2B1 RNA

In vitro decay of capped and poly(A⁺) radiolabelled 2B1 or 2B1-del 4 RNA (2.5 ng/20 μl) was examined in the presence of LVM nuclear protein extract (10 μg/20 μl) (RNA domains are defined in Figure 3B). The experiment was carried out with three replicates for 0 min, and four replicates for 20 and 40 min. (A) PhosphorImages of triplicate gels. (B) Histogram showing means±S.E.M. of relative intensities of the bands, taking the mean intensity at 0 min as 100%. Asterisks (*) indicate that the relative intensity differed significantly from the control without any added unlabelled RNA. The entire experiment was replicated three times.