Alternative tRNA priming of human immunodeficiency virus type 1 reverse transcription explains sequence variation in the primer-binding site that has been attributed to APOBEC3G activity

Abstract

It is generally assumed that human immunodeficiency virus type 1 (HIV-1) uses exclusively the cellular tRNA(3)(Lys) molecule as a primer for reverse transcription. We demonstrate that HIV-1 uses not only tRNA(3)(Lys) but also an alternative tRNA primer. This tRNA was termed tRNA(5)(Lys), and the near completion of the human genome project has allowed the identification of four tRNA(5)(Lys)encoding genes. Priming with tRNA(5)(Lys) results in a single nucleotide polymorphism in the viral primer-binding site that is present in multiple natural and laboratory HIV isolates. This sequence variation was recently attributed to APOBEC3G activity. However, our results show that alternative tRNA priming can cause this mutation in the absence of APOBEC3G.

FIG. 1.

A variant tRNA^Lys molecule is used in HIV-1 reverse transcription. (a) The human genome contains nine tRNA^Lys(UUU)-encoding genes. Shown is the sequence alignment with nucleotides that differ from the sequence marked by a shaded box. The chromosome containing the tRNA-encoding gene has been indicated. The genome contains four copies of the -encoding gene (two on chromosome 1 and one each on chromosomes 6 and 11). The tRNA^Lys-encoding genes with the G-to-A substitution in the PBS-binding domain (indicated by the arrow) have arbitrarily been named to . The CCA terminus (shown in lowercase) is added posttranscriptionally. Posttranscriptional base modifications are not shown. (b) Secondary structures of and . A shaded box marks the typical nucleotide substitutions in . The G-to-A substitution in the PBS-binding domain is indicated by the arrow. (c) tRNA primer identification assay. HIV-1 strain LAI particles produced by SupT1 cells were incubated with 200 μM dNTPs and 10 mM MgCl₂ to trigger endogenous (intravirion) reverse transcription (22). The newly made cDNA-tRNA molecules were extracted from the virions by sodium dodecyl sulfate-proteinase K treatment and phenol-chloroform extraction (8) and subsequently copied in an exogenous (in vitro) reverse transcription reaction with Thermoscript reverse transcriptase (Invitrogen) and primer 1 (5′ TAGAGATCCCTCAGACCCTTT) at 55°C. The resulting cDNAs were PCR amplified with Taq polymerase and primers 1 and 2 (5′ CTGAGGGTCCAGGGTTCAAGTCC), cloned into a TA cloning vector, and sequenced. The PBS-binding domain sequence observed in 90 cDNA-tRNA clones is shown. The nucleotide characteristic for priming with or has been shaded. The viral PBS motif is shown as a gray box; the PBS-binding domain (PBS-BD) of the priming tRNA molecule is shown as an open box.