Plasmid- and chromosome-encoded redundant and specific functions are involved in biosynthesis of the siderophore anguibactin in Vibrio anguillarum 775: a case of chance and necessity?

Abstract

We report the identification of a novel chromosome cluster of genes in Vibrio anguillarum 775 that includes redundant functional homologues of the pJM1 plasmid-harbored genes angE and angC that are involved in anguibactin biosynthesis. We also identified in this cluster a chromosomal angA gene that is essential in anguibactin biosynthesis.

FIG. 1.

Scheme of the anguibactin biosynthesis pathway and arrangement of biosynthetic genes in the plasmid and chromosome clusters. (A) Anguibactin biosynthesis pathway. The AngE, AngA, and AngC enzymes are described in the text. The asterisk beside AngD means that this is a putative enzyme whose activity has yet to be proven. For a more detailed pathway, see Crosa and Walsh (13). (B) Genetic arrangement of the angC, angE, and angA genes in the pJM1 plasmid and chromosomal DNA. The intergenic region located between angA_ch and angC_ch and the angC_p promoter are also shown. In this work we identified a chromosomal dahp gene, a homologue to that encoded on the pJM1 plasmid (15), that encodes a predicted translated protein similar to 3-deoxy-d-arabino-heptulosonate-7-phosphate synthases. The first codon and the −10 and −35 regions of each gene are underlined; +1 indicates the transcription start sites of each gene determined using primer extension analysis (26). The direction of transcription is denoted by horizontal arrows. For the primer extension analysis, the RNAWiz (Ambion) was used to extract total RNA from V. anguillarum strain 775 grown in CM9 supplemented with 2.5 μM EDDA. The primers used in these experiments were as follows: C2 (5′ TAGCTGATTAGCCATTTTTGAAAACCC 3′) located 45 bp downstream from the start codon of the angC_ch gene, CPB (5′ GGATCCAAAAAAGAACGGTGATTTTAA 3′) located 118 bp downstream from the start codon of the angC_p gene, and A3 (5′ ATTTTTATCCGTCGCTACAACTCG 3′) and CCK (5′ GGTACCATTTTCCTAACTTTACTCCGTT 3′) located 114 and 8 bp downstream from the start codon of the angA_ch gene, respectively. The symbols shown with the angA_p gene and downstream of the angE_ch gene indicate a frame shift and a transcriptional terminator, respectively. The double diagonal lines between the isv-A2 and dahp genes in the plasmid cluster indicate approximately 12 kbp. The putative Fur boxes are shaded, and nucleotides identical to the E. coli Fur consensus (16) are shown in bold characters.

FIG. 2.

Detection of siderophore production on CAS agar plates in V. anguillarum strains. (A) From left to right: wild-type V. anguillarum strain 775, AC1 (ΔangE_p), AC2 (ΔangE_ch), and AC3 (ΔangE_p ΔangE_ch). (B) Genetic complementation of the double ΔangE_p ΔangE_ch (AC3) mutant strain with each wild-type angE gene. From left to right: the AC3 strain complemented with the angE_p gene (AC4), complemented with the angE_ch gene (AC5), and harboring the empty vector pMMB208 (AC6). (C) From left to right: AC11 (ΔangC_p), AC12 (ΔangC_ch), AC13 (ΔangC_p ΔangC_ch), and AC17 (ΔangC_p ΔangC_ch ΔmenF). (D) Genetic complementation of the double ΔangC_p ΔangC_ch (AC13) mutant strain with each wild-type angC gene. From left to right: the AC13 strain complemented with the angC_p gene (AC14), complemented with the angC_ch gene (AC15), and harboring the empty vector pMMB208 (AC16). (E) From left to right: AC7 (ΔangA_ch mutant strain) and the ΔangA_ch (AC7) mutant strain complemented with the angA_ch gene (AC8), complemented with the angA_p gene (AC9), and harboring the empty vector pMMB208 (AC10). For the complementation experiments the plates were supplemented with 10 μg of chloramphenicol/ml and 1 mM IPTG to induce the genes cloned under the control of the inducible Ptac promoter.

FIG. 3.

Transcriptional regulation analysis by RPA of the angE_p and angE_ch genes. Total RNA was harvested from each strain grown under the conditions indicated for each lane. The riboprobes were synthesized using the Maxiscript T7/T3 kit from Ambion. In these experiments we used the aroC gene as an internal control because it was previously established that this gene is not regulated by iron (9). For aroC we used the plasmid pQSH6 (linearized with RsaI) (10, 15) and p32 for angE_ch gene. For the angE_p homologue we designed the primers EPPU (5′ CCGATAGATATCATCACGAAA 3′) and EPPRT7 (5′ TAATACGACTCACTATAGGGCGCGTAAAATCCGTTTTTATC 3′). The RPA assay was performed using the RPA III kit (Ambion) according to the manufacturer's specifications. Specific transcripts for aroC, angE_ch, and angE_p were detected using the riboprobes synthesized as described above. (A) Analysis of the angE_p gene. Lanes: 1, 2, and 3, RNA extracted from the V. anguillarum 775 MET 11 fur strain grown in CM9 supplemented with 4 μg of FAC, CM9, and CM9 supplemented with 2.5 μM EDDA/ml, respectively; 4, 5, and 6, RNA extracted from V. anguillarum strain 775 grown under the same conditions as described previously; 7, aroC riboprobe; 8, angE_p riboprobe. (B) Analysis of the angE_ch gene. Lanes 1, 2, and 3: RNA extracted from V. anguillarum strain 775 grown in CM9 supplemented with 4 μg of FAC, CM9, and CM9 supplemented with 2.5 μM EDDA/ml, respectively. (C) Lanes 1, 2, and 3: same as described for panel B but using RNA from the V. anguillarum fur mutant strain. Lanes 4 and 5 of both panels show the aroC and angE_ch riboprobes.