An end-healing enzyme from Clostridium thermocellum with 5' kinase, 2',3' phosphatase, and adenylyltransferase activities

Abstract

We identify and characterize an end-healing enzyme, CthPnkp, from Clostridium thermocellum that catalyzes the phosphorylation of 5'-OH termini of DNA or RNA polynucleotides and the dephosphorylation of 2',3' cyclic phosphate, 2'-phosphate, and 3'-phosphate ribonucleotides. CthPnkp also catalyzes an autoadenylylation reaction via a polynucleotide ligase-type mechanism. These characteristics are consistent with a role in end-healing during RNA or DNA repair. CthPnkp is a homodimer of an 870-amino-acid polypeptide composed of three catalytic domains: an N-terminal module that resembles the polynucleotide kinase domain of bacteriophage T4 Pnkp, a central metal-dependent phosphoesterase module, and a C-terminal module that resembles the nucleotidyl transferase domain of polynucleotide ligases. The distinctive feature of CthPnkp vis-à-vis known RNA repair enzymes is that its 3' end modification component belongs to the calcineurin-type phosphatase superfamily. It contains putative counterparts of the amino acids that form the dinuclear metal-binding site and the phosphate-binding site of bacteriophage lambda phosphatase. As with lambda phosphatase, the 2',3' cAMP phosphatase activity of CthPnkp is specifically dependent on nickel or manganese. We identify homologs of CthPnkp in other bacterial proteomes.

FIGURE 1.

A new family of bacterial Pnkp proteins. The amino acid sequence of C. thermocellum Pnkp (Cth; NCBI accession ZP_00312808) is aligned to homologous polypeptides encoded by Kineococcus radiotolerans (Kra; NCBI accession ZP_00354175), Nostoc sp. PCC 7120 (Nostoc; NCBI accession BAB75430), and Streptomyces coelicolor (Sco, NCBI accession NP_630089). Gaps in the alignment are indicated by dashes. Positions of amino acid side-chain identity or similarity in all four proteins are indicated by dots above the alignment. The polynucleotide kinase, phosphoesterase, and nucleotidyltransferase motifs are highlighted in shaded boxes. The translation start sites and stop sites of truncated versions of CthPnkp are indicated by arrows.

FIGURE 2.

Kinase and adenylyltransferase activities of recombinant CthPnkp proteins. (A) Aliquots (5 μg) of the Ni-agarose preparations of recombinant full-length wild-type (WT) His₁₀-CthPnkp; full-length mutant proteins K531A, H532A, and R536A; and truncated proteins CthPnkp-(1–425), CthPnkp-(433–870), and CthPnkp-(462–870) were analyzed by SDS-PAGE. The Coomassie blue–stained gel is shown. The positions and sizes (kDa) of marker polypeptides are indicated on the left. (B) Adenylyltransferae activity. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM MgCl₂, 5 mM DTT, 20 μM [α-³²P]ATP, and 2 μg of the indicated protein preparation were incubated for 15 min at 45°C. The products were analyzed by SDS-PAGE and visualized by autoradiography. The positions and sizes (kDa) of marker polypeptides are indicated on the left. (C) Kinase activity. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM DTT, 10 mM MgCl₂, 100 pmol of a 36-mer 5′-OH oligodeoxyribonucleotide 5′-d(TGTAGTCACTATCG GAATAAGGGCGACACGGATATG), 100 μM [γ-³²P]ATP, and 50 ng of the indicated protein preparation were incubated for 30 min at 45°C. The products were analyzed by PAGE and visualized by autoradiography.

FIGURE 3.

Glycerol gradient sedimentation of CthPnkp. Sedimentation was performed as described in Materials and Methods. (A) Aliquots (10 μL) of the even-numbered gradient fractions were analyzed by SDS-PAGE. The Coomassie blue–stained gel is shown. The positions of the recombinant Pnkp protein and the internal standards catalase, BSA, and cytochrome c are indicated. (B) Adenylyltransferase reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 10 mM MgCl₂, 5 mM DTT, 100 μM [α-³²P]ATP, and 2 μL of the indicated glycerol gradient fractions were incubated for 15 min at 45°C. The products were analyzed by SDS-PAGE and visualized by autoradiography. The positions and sizes (kDa) of marker polypeptides are indicated on the left. (C) Kinase reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM DTT, 10 mM MgCl₂, 100 pmol of a 36-mer 5′-OH oligodeoxyribonucleotide, 100 μM [γ-³²P]ATP, and 2 μL of a 1:20 dilution of the indicated glycerol gradient fractions were incubated for 30 min at 45°C. The products were analyzed by PAGE and visualized by autoradiography. (D) Phosphatase reactions mixtures (50 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM NiCl₂, 5 mM 2′,3′ cAMP, and 4 μL of the even-numbered gradient fractions were incubated for 30 min at 45°C. Release of P_i was measured with the malachite green reagent.

FIGURE 4.

Characterization of the 5′ kinase reaction. (A) Enzyme titration. Reaction mixtures (10 mL) containing 50 mM Tris-acetate (pH 7.0), 5 mM DTT, 10 μM MgCl₂, 100 μM [γ-³²P]ATP, 100 pmol 36-mer 5′-OH DNA, and CthPnkp as specified were incubated for 30 min at 45°C. (B) pH dependence. Reaction mixtures (10 μL) containing 50 mM buffer (either Tris-formate at pH 3.5; Tris-acetate at pH 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, or 7.0; or Tris-HCl at pH 7.5, 8.0, 8.5, 9.0 or 9.5), 5 mM DTT, 10 mM MgCl₂, 100 μM [γ-³²P]ATP, 100 pmol 36-mer 5′-OH DNA, and 8 ng CthPnkp were incubated for 30 min at 45°C. (C) ATP dependence. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM DTT, 10 mM MgCl₂, 100 pmol 36-mer 5′-OH DNA, 8 ng CthPnkp, and [γ-³²P]ATP as specified were incubated for 30 min at 45°C.

FIGURE 5.

Metal specificity and RNA kinase activity. (A) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 100 μM [γ-³²P]ATP, 100 pmol 36-mer 5′-OH DNA, 8 ng CthPnkp, and either no divalent cation (lane −) or 5 mM MgCl₂, MnCl₂, CaCl₂, CdCl₂, CoCl₂, NiCl₂, or ZnCl₂ as specified were incubated for 30 min at 45°C. The products were analyzed by PAGE and visualized by autoradiography. The relative kinase activities (normalized to the magnesium-containing reaction, defined as 100%) are indicated below the lanes. (B) RNA kinase activity. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM DTT, 10 mM MgCl₂, 100 μM [γ³²P]ATP, 50 ng of CthPnkp, and 100 pmol of 5′-OH–terminated 18-mer, 15-mer, 12-mer, or 9-mer oligonucleotides as specified were incubated for 30 min at 45°C. The prodducts were analyzed by PAGE and visualized by autoradiography.

FIGURE 6.

Characterization of the 2′,3′ phosphatase activity. (A) pH dependence. Reaction mixtures (50 μL) containing 50 mM buffer (either Tris-acetate at pH 4.5, 5.0, 5.5, 6.0, 6.5, or 7.0; or Tris-HCl at pH 7.5, 8.0, 8.5, or 9.0), 5 mM DTT, 5 mM 2′,3′ cAMP, and either 5 mM MnCl₂ and 2 μg CthPnkp or 5 mM NiCl₂ and 1 μg CthPnkp as specified were incubated at 30 min at 45°C. (B) cAMP dependence. Reactions mixtures (50 μL) containing 50 mM Tris-acetate (pH 7.0), 10 mM NiCl₂, 1 μg CthPnkp, and 2′,3′ cAMP as specified were incubated for 30 min at 45°C. (C) Substrate specificity. Reactions mixtures (50 μL) containing 50 mM Tris-acetate (pH 7.0); 10 mM NiCl₂; 1 μg CthPnkp; and 5 mM 2′,3′ cAMP, 3′,5′ cAMP, 2′ AMP, 3′ AMP, or 5′ AMP as specified were incubated for 30 min at 45°C.

FIGURE 7.

Divalent cation specificity and dependence of the adeny-lyltransferase reaction. (A) Divalent cation specificity. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0); 100 μM [α-³²P]ATP; 2 μg CthPnkp; and either no divalent cation (lane −) or 10 mM MgCl₂, MnCl₂, CaCl₂, CdCl₂, CoCl₂, NiCl₂, or ZnCl₂ as specified were incubated for 15 min at 45°C. (B) Divalent cation dependence. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0); 5 mM DTT; 100 μM [α-³²P]ATP; 2 μg CthPnkp; and either 0, 0.63, 1.25, 2.5, 5, or 10 mM MgCl₂ (•) or MnCl₂ (○) were incubated for 15 min at 45°C. The yield of enzyme-AMP adduct (E-AMP) is plotted as a function of divalent cation concentration.

FIGURE 8.

pH- and ATP-dependence of the adenylyltransferase reaction. (A) Reaction mixtures (10 μL) containing 50 mM buffer (either Tris-formate at pH 3.5; Tris-acetate at pH 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, or 7.0; or Tris-HCl at pH 7.5, 8.0, 8.5, 9.0, or 9.5), 5 mM DTT, 10 mM MgCl₂, 100 μM [α-³²P]ATP, and 2 μg CthPnkp were incubated at 45°C for 15 min. (B) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 7.0), 5 mM DTT, 10 mM MgCl₂, 2 μg CthPnkp, and [α-³²P]ATP as specified were incubated at 45°C for 15 min.

FIGURE 9.

Bacterial Pnkp/adenylyltransferase homologs. The aligned amino acid sequences of putative trifunctional kinase-phosphatase-adenylyltransferases from Fusobacterium nucleatum (Fnu; NCBI accession EAA24876), Bacillus licheniformis (Bli; NCBI accession YP_079636), and Helicobacter hepaticus (Hhe; NCBI accession AAP78353) are shown. Gaps in the alignment are indicated by dashes. The polynucleotide kinase, calcineurin-type phosphoesterase, and nucleotidyltransferase motifs are highlighted in shaded boxes.