Putative DNA quadruplex formation within the human c-kit oncogene

Abstract

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Figure 1

The c-kit native and modified sequences studied in this work. The regions that may form G-tetrad planes are highlighted in red with the loop regions shown in black.

Figure 2

(a) One-dimensional 500 MHz proton spectrum of the c-kit native sequence. Experimental conditions: strand concentration, 2 mM; temperature, 25 °C, 100 mM KCl; potassium phosphate, 20 mM, pH 7.0. (b) One-dimensional 500 MHz proton spectra of the c-kit native sequence at various temperatures. Experimental conditions: strand concentration, 2 mM; 100 mM KCl; potassium phosphate, 20 mM, pH 7.0.

Figure 3

Normalized absorbance plots at 295 nm versus temperature, with strand concentration of 20 μM, 10 mM sodium cacodylate pH 7.0 buffer, and 100 mM KCl. (a) For the c-kit native sequence: open circles represent cooling curves; filled circles represent heating curves. (b) For c-kit modified sequences: mod 1 (blue), mod 2 (red), and mod 3 (green). The heating and cooling curves are marked H and C, respectively.

Figure 4

(a) CD spectrum of c-kit native sequence. (b) CD spectra of the modified sequences: mod 1 (black), mod 2 (blue), and mod 3 (magenta).

Figure 5

Imino and amino proton regions from 1D ¹H NMR spectra of the c-kit modified sequences.