Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Review
. 2004:69:55-66.
doi: 10.1101/sqb.2004.69.55.

The Air noncoding RNA: an imprinted cis-silencing transcript

G Braidotti  1 , T Baubec, F Pauler, C Seidl, O Smrzka, S Stricker, I Yotova, D P Barlow
Affiliations
Review

The Air noncoding RNA: an imprinted cis-silencing transcript

G Braidotti et al. Cold Spring Harb Symp Quant Biol. 2004.
No abstract available

PubMed Disclaimer

Figures

Figure 1
Figure 1
The mouse proximal 17 imprinted cluster (top box) and the syntenic human region on 6q27 (bottom box). Genes are positioned above or below the map according to the direction of transcription and their size indicated by the length of the box. Both regions are gene rich and show surprising conservation (n.b., LPAL2 is a human-specific duplication of Plg); the white boxes in the mouse sequence indicate gaps. On the mouse map, the three maternally expressed imprinted genes are shown as striped boxes; the paternally expressed Air ncRNA is shown as a dotted box. The two regions are aligned (vertical dotted line) at the CpG island (*) in Igf2r intron 2 that is common to both mouse and human sequences, which in the mouse is the promoter for the Air ncRNA. The mouse Air ncRNA is 108-kb long and spans from Igf2r intron 2 to the Mas last intron. No human “H”AIR transcripts have been reported in the region between human IGF2R and MAS. Both maps were based on those shown in http://www.ensemble.org/.
Figure 2
Figure 2
Control experiments for RNA FISH. (A–D) Diploid NIH 3T3 cells hybridized with an Igf2r strand-specific probe (green). (E) Thp/+ MEFs hybridized with an Air strand-specific probe (green). (F) +/Thp MEFs hybridized with an Air strand-specific probe. The RNA specific signal from Igf2r is seen in D. The paternal specific expression of Air is seen in E, since Thp/+ cells have a deletion on the maternal chromosome that removes the proximal Chr.17 imprinted cluster. In this and subsequent RNA FISH images, the probes were single stranded and derived from linear PCR. Two Air-strand-specific probes (FAS1 and 2) were amplified from cloned genomic DNA from Igf2r intron 1 (TGTCAAGGAGAACTGAGCGTCAT) or intron 2 (GGTAGGATGGTGTCTTACTC). The Igf2r-strand-specific probe (FcDNA) was amplified from the full-length mouse cDNA using an exon 28 primer (GTTTTCGAAAGTCAGCTTCTGGC). Probes were labeled with either Digoxigenin or Biotin and detected by anti-Digoxigenin or Avidin antibody conjugated with FITC (green) or Rhodamine (red; see examples in Figs. 3–6). Nuclei were stained with DAPI. The full RNA FISH protocol and image capture has been described (Braidotti 2001).
Figure 3
Figure 3
Four examples of Air RNA FISH showing (A) a single signal and (B–D) the clustered spots that appeared in 16% of diploid NIH 3T3 cells or Thp/+ MEFs. An enlarged image for the signals and clusters is shown in the top right of each picture.
Figure 4
Figure 4
RNA FISH showing cohybridization of diploid and tetraploid NIH 3T3 cells with Igf2r-specific (green) and Air-specific (red) probes.
Figure 5
Figure 5
RNA FISH showing Air clustered signals (red) dissociated from chromosomes. Air clusters are seen in interphase nuclei (A), early metaphase nuclei (B and C show two focal planes in the same cell), and in metaphase (D).
Figure 6
Figure 6
Air RNA FISH (red) combined with gamma tubulin immunofluorescence (green) in NIH 3T3 cells. Gamma tubulin antibody from Dr. Dagmar Ivanyi, NKI, Amsterdam. The top left image shows that Air is localized away from the centrosome, while the three other images show that Air is adjacent to the centrosome.
Figure 7
Figure 7
An RNase protection assay for Air (A) shows that Air is not expressed in ES cells but is abundant in ES cells differentiated by exposure for 5 days to retinoic acid. gapdh expression is used as the loading control (P, probe; t, tRNA). (B) The weak Air RNA FISH signal (white arrows) seen in ES cells that were not reproducible enough to count accurately. (C) The strong Air RNA FISH signal seen in 34% of differentiated cells. The three smaller images in C show examples of the Air signal clusters seen in these cells.
See this image and copyright information in PMC

References

    1. Avner P, Heard E. X-chromosome inactivation: Counting, choice and initiation. Nat. Rev. Genet. 2001;2:59. - PubMed
    1. Baroux C, Spillane C, Grossniklaus U. Genomic imprinting during seed development. Adv. Genet. 2002;46:165. - PubMed
    1. Beechey CV, Cattanach BM, Blake A. World Wide Web site—Mouse Imprinting Data and References. 2003. MRC Mammalian Genetics Unit, Harwell, Oxfordshire. ( http://www.mgu.har.mrc.ac.uk/research/imprinting/)
    1. Bell AC, Felsenfeld G. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature. 2000;405:482. - PubMed
    1. Bongiorni S, Prantera G. Imprinted facultative heterochromatization in mealybugs. Genetica. 2003;117:271. - PubMed

Publication types

LinkOut - more resources