DNA looping-mediated repression by histone-like protein H-NS: specific requirement of Esigma70 as a cofactor for looping

Abstract

Transcription initiation by RNA polymerase (RNP) carrying the house-keeping sigma subunit, sigma70 (Esigma70), is repressed by H-NS at a number of promoters including hdeABp in Escherichia coli, while initiation with RNP carrying the stationary phase sigma, sigma38 (Esigma38), is not. We investigated the molecular mechanism of selective repression by H-NS to identify the differences in transcription initiation by the two forms of RNPs, which show indistinguishable promoter selectivities in vitro. Using hdeABp as a model promoter, we observed with purified components that H-NS, acting at a sequence centered at -118, selectively repressed transcription by Esigma70. This selective repression is attributed to the differences in the interactions between hdeABp and the two forms of RNPs, since no other factor is required for the repression. We observed that the two forms of RNPs could form an open initiation complex (RP(O)) at hdeABp, but that Esigma70 failed to initiate transcription in the presence of H-NS. Interestingly, KMnO4 assays and high-resolution atomic force microscopy (AFM) revealed that hdeABp DNA wrapped around Esigma70 more tightly than around Esigma38, resulting in the potential crossing over of the DNA arms that project out of Esigma70 . RP(O) but not out of Esigma38 . RP(O). Based on these observations, we postulated that H-NS bound at -118 laterally extends by the cooperative recruitment of H-NS molecules to the promoter-downstream sequence joined by wrapping of the DNA around Esigma70 . RP(O), resulting in effective sealing of the DNA loop and trapping of Esigma70. Such a ternary complex of H-NS . Esigma70 hdeABp was demonstrated by AFM. In this case, therefore, Esigma70 acts as a cofactor for DNA looping. Expression of this class of genes by Esigma38 in the stationary phase is not due to its promoter specificity but to the architecture of the promoter . Esigma38 complex.

Figure 1.

Regulatory effect of H-NS. (A) Expression from hdeABp (-136 to +120) fused to lacZYA was determined in vivo in the wild-type background (circles), in the RpoS^- mutant background (triangles), and in the RpoS^- and Hns^- double-mutant background (squares). λ Lysogens carrying the hdeABp::lacZYA were used for the assay. The expression from hdeABp was determined by β-galactosidase assay during bacterial growth into stationary phase. Open symbols represent the bacterial cell mass (A₆₀₀, right axis) and closed symbols represent β-galactosidase activity (A₄₂₀/min/mL/A₆₀₀, Miller unit, left axis). (B) Regulatory effect of H-NS as determined by in vitro transcription assay using purified components. DNA templates were supercoiled plasmid DNA that carried hdeABp(-136 to +120, panels 1 and 2)or lacUV5p(-130 to +55, panel 3). Transcription was catalyzed by Eσ⁷⁰ (panels 1 and 3) or Eσ³⁸ (panel 2). H-NS concentrations in each reaction were 0 (lane 1), 8 nM (lane 2), 25 nM (lane 3), 76 nM (lane 4), and 228 nM (lane 5). The radioactive transcripts were analyzed on an 8 M urea/8% polyacrylamide gel. The major transcripts from the test promoters and rna1 are indicated.

Figure 2.

Identification of DNA-binding site on hdeABp at which H-NS exerts its regulatory effect. (A) Gel mobility shift assay with hdeABp DNA constructs with various 5′ ends and a fixed 3′ end (+120), and H-NS separated on a 5% native polyacrylamide gel. Heparin was added at 34μg/mL prior to loading the reaction mixes onto the gel. The H-NS added in the incubation mix was 0 (lane 1), 76 nM (lane 2), and 228 nM (lanes 3). (B) H-NS titration of in vitro transcription, as described in Figure 1, using hdeABp DNA templates with different 5′ ends and a fixed 3′end at +120 (panels 1–3) and hdeABp DNA template carrying the sequence between -136 to +20 (panel 4). H-NS added in the preincubation mix was 0 (lane 1), 25 nM (lane 2), 76 nM (lane 3), and 228 nM (lane 4). (C) The hdeABp sequence. The AT tract centered at -118 nt at which H-NS is thought to bind and -35, -10, and +1 elements are underlined.

Figure 3.

Simultaneous binding of H-NS and RNP to hdeABp DNA (-136 to +120), as assessed by gel mobility shift (A) and Western analysis (B for Eσ⁷⁰ binding and C for Eσ³⁸ binding). See text for details. Proteins present in the assays are indicated above each lane. (A) A gel mobility shift assay with 228 nM H-NS and/or 20 nM RNP. For lanes 4 and 6, the DNA was first incubated with H-NS for 10 min and subsequently with RNP for 10 min. (B,C) The hdeABp DNA was incubated in the presence of increasing concentrations of H-NS: 0 (lane 1); 25 nM (lanes 2,5); 76 nM (lanes 3,6); 228 nM (lanes 4,7). For lanes 5–7, 20 nM of RNP was added after incubation of hdeABp DNA and H-NS and the incubation continued an additional 10 min. Panels on the left show gel mobility shift assays on 5% native polyacrylamide gels. The gels were transferred to PVDF membranes and probed with antibody against the α subunit of RNP (middle panels) or H-NS (right panels). Bound antibodies were detected by ECL. The closed arrows indicate ternary complexes of DNA · RNP · H-NS and open arrows indicate binary complexes of DNA · H-NS.

Figure 4.

DNA kinks induced by RNP (20 nM, A,B) and/or H-NS binding (228 nM, C,D) to hdeABp DNA (-136 to +120) as probed by KMnO₄ assay. Unpaired bases were revealed by primer extension since a supercoiled DNA template was used (see Materials and Methods). A and C show the result of analysis using the primer with the top sequence, and B and D show the result of analysis using the primer with the bottom strand (see Materials and Methods). A and B show the entire sequencing gels, and C and D show those bases around the -10 hexamer. Asterisks indicate unpaired bases at or near the -10 element; open and closed arrowheads indicate those induced by Eσ⁷⁰ and Eσ³⁸ binding, respectively; and gray arrowheads indicate those induced by both RNPs. The first four lanes in each panel show the DNA sequencing ladder. E shows the top strand bases hyper-reactive to KMnO₄ induced by Eσ⁷⁰ binding (carets above bases) or by Eσ³⁸ binding (carets below bases). The -35, -10, and +1 elements are underlined.

Figure 5.

Effect of lengthening the interval between H-NS-binding site and hdeABp on H-NS-mediated regulation. DNA fragments increasing by 5-bp increments were inserted at -44.5 nt of the hdeABp DNA (-136 to +30). Inserted DNA fragments were ATCGA (5 bp), CTAGAAACGA (10 bp), CTAGAGCTCGAGCGA (15 bp), and CTAGACCATGGCTCGATCGA (20 bp). (A) Using the hdeABp carrying the above inserts, the repressive effect of H-NS was analyzed by in vitro transcription assay using the procedure described in Figure 1B. H-NS concentrations were 0 (lane 1), 25 nM (lane 2), 76 nM (lane 3), and 228 nM (lane 4). (B) The RNA transcripts were quantified with a β scanner (FLA3000), and the fraction (percent) of RNA in each lane relative to RNA made in the absence of H-NS was plotted as a function of H-NS concentration. (○) hdeABp DNA template carrying no insert; (•) hdeABp DNA template carrying a 5-bp insert; (▵) hdeABp DNA template carrying a 10-bp insert; (▴) hdeABp DNA template carrying a 15-bp insert; and (□) hdeABp DNA template carrying a 20-bp insert.

Figure 6.

Atomic force microscopy images of representative RNP (20 nM) bound to hdeABp DNA (-216 to +580) in the presence or absence of H-NS (228 nM). A and B show representative montages of Eσ⁷⁰ and Eσ³⁸ stably bound to hdeABp DNA, respectively. RNP molecules are seen as bright dots. C and D show a montage of representative ternary complexes formed when H-NS bound to hdeABp DNA complexed with Eσ⁷⁰ (C) or Eσ³⁸ (D). These images show thickening of the DNA arms by H-NS binding, which cross-bridged DNA in the presence of Eσ⁷⁰ (C). No such DNA bridging was observed with Eσ³⁸ (D). All images show a 300 × 300-nm surface area. Color represents height ranging from 0 to 5 nm from dark to bright. (E) Average contour length of free DNA and RNP-bound DNA. DNA contour length values are the average of at least 20 measurements for each condition. Figures in parentheses are standard deviations. (F) Schematic view of H-NS and two forms of RNPs bound to hdeABp DNA. (Left) Eσ⁷⁰ binding induces kinks into the target DNA, facilitating oligomerization of the bound H-NS molecules on the DNA arms project out of an Eσ⁷⁰ · RP_O. (Right) H-NS bound to the upstream arm fails to extend to downstream DNA due to the steric distance between the two DNA arms leaving Eσ³⁸ · RP_O.