SigF, a new sigma factor required for a motility system of Myxococcus xanthus

Abstract

A new sigma factor, SigF, was identified from the social and developmental bacterium Myxococcus xanthus. SigF is required for fruiting body formation during development as well as social motility during vegetative growth. Analysis of gene expression indicates that it is possible that the sigF gene is involved in regulation of an unidentified gene for social motility.

FIG. 1.

Alignment of amino acid sequences of sigma factors of M. xanthus. The functions of the subregions are denoted below the sequences (7, 14). The amino acid residues conserved in more than three sigma factors are indicated by black backgrounds. Numbers on the right-hand side indicate residues from the N-terminal ends. The subregions are denoted by the dotted lines under the sequences (14). Potential helix-turn-helix motifs are underlined.

FIG. 2.

Expression of the sigF gene. (A) Primer extension analysis. Total RNA was prepared from vegetative cells in CYE liquid medium (lane V) and 12-h-developmental cells on CF agar plates (lane D). Lanes G, A, T, and C represent sequence ladders generated by the same primer used in the primer extension reaction. (B) Sequences of the promoter region of the sigF gene. The 5′ ends of the mRNA are indicated by arrows. The initiation codon is indicated by Met. The region corresponding to the primer (5′CAAAGGACACGTTCAGGTTGA3′) used in the primer extension analysis is underlined.

FIG. 3.

Fruiting body development. DZF1 and sigF::km cells were spotted on CF and TPM agar plates at densities of 1 × 10¹⁰ cells/ml (A) and 2 × 10⁹ cells/ml (B). Photographs were taken by a Polaroid camera under a dissecting microscope after a 5-day incubation at 30°C.

FIG. 4.

Motility behavior during vegetative growth. Vegetative cells of DZF1 and sigF::km strains were spotted on CYE plates containing 0.3% (A) and 1.5% (B) agar at a density of 5 × 10⁸ cells/ml and incubated at 30°C for 3 days. Photographs of the entire colony were taken directly by a Polaroid camera. Photographs of the colony edge were taken by a Polaroid camera under a dissecting microscope.