Deacetylation of the herpes simplex virus type 1 latency-associated transcript (LAT) enhancer and a decrease in LAT abundance precede an increase in ICP0 transcriptional permissiveness at early times postexplant

Abstract

Only the latency-associated transcript (LAT) of the herpes simplex virus type 1 (HSV-1) genome is transcribed during latency, while the lytic genes are suppressed, possibly by LAT antisense mechanisms and/or chromatin modifications. In the present study, latently infected dorsal root ganglia were explanted to assess both relative levels of LAT and histone H3 (K9, K14) acetylation of the LAT locus and ICP0 promoter at early times postexplant. We observed that a decrease in both LAT enhancer histone H3 (K9, K14) acetylation and LAT RNA abundance occurs prior to an increase in acetylation, or transcriptional permissiveness, at the ICP0 promoter.

FIG. 1.

Diagram of the HSV-1 genome. Regions of the long and short repeat (R_L and R_S, respectively) that have been analyzed for H3 acetylation are indicated by gray or black bars. The LAT promoter and enhancer components are encompassed by the reactivation critical region (rcr). These elements are maintained in a hyperacetylated state during latency, as indicated by the gray bar. The antisense immediate-early ICP0 and ICP4 promoters exist in a hypoacetylated state during latency, as indicated by the black bars. U_L, unique long region; U_S, unique short region.

FIG. 2.

LAT RNA levels decrease at early times postexplant. RNA was isolated and pooled from DRG (4/mouse) explanted from three mice latently infected with 1 × 10⁵ PFU/mouse of HSV-1 strain KOS as described previously (8). cDNA was analyzed in triplicate by real-time PCR using primers and a probe specific for the 5′ exon of the LAT (nucleotides 119326 to 119397) (8). Relative quantities of LAT RNA were normalized to the PCR of the cellular genes Xist (8) or APRT (forward, CTCAAGAAATCTAACCCCTGACTCA; reverse, GCGGGACAGGCTGAGA; probe, CCCCACACACACCTC). The results of two independent experiments are graphed as percent LAT 5′ exon RNA relative to the RNA level of the 0-hpe time point.

FIG. 3.

Explant causes a decrease in acetylation of the LAT enhancer, which precedes an increase in acetylation of the ICP0 promoter. ChIP analysis was performed as previously described (8) using DRG (6/mouse) explanted from mice latently infected with 1 × 10⁵ PFU/mouse of HSV-1 strain KOS. Samples were analyzed in triplicate by real-time PCR. (A) Results from experiment 1 show the percentages of bound/input ratios relative to the 0-hpe time point for the postexplant times indicated. Two mice were used per time point. (B and C) Experiments 2 and 3, respectively, show the percentages of bound/input ratios normalized to APRT bound/input ratios and relative to the 0-hpe time point for the postexplant times indicated. Four mice were used per time point. B/I, bound/input.

FIG. 4.

LAT RNA levels remain low and the ICP0 promoter remains in a transcriptionally permissive state through 12 hpe. (A) Analysis of three independent ChIP experiments at 8 and 12 hpe. Three mice per time point per ChIP were precipitated with anti-H3 K9, 14 acetyl and analyzed by TaqMan PCR with primers and probes for the LAT promoter, 5′ exon, and ICP0 promoter. The ICP0 promoter remains hyperacetylated, though there is an apparent increase in the relative level of LAT 5′ exon acetylation by 12 hpe. (B) LAT and ICP0 RNA at 0, 8, and 12 hpe from three independent experiments of explanted DRG was analyzed by TaqMan real-time PCR. Reverse transcription using random decamer primers (Ambion) or a strand-specific primer for the ICP0 transcript (LAT I-1, GACACGGATTGGCTGGTGTAGTGGG; nucleotides 120797 to 120820) was performed using Omniscript reverse transcriptase (QIAGEN) according to the manufacturer's instructions. The cDNA was then analyzed with primers and probes for ICP0 (forward, GGCCGAGGGAGGTTTCC, nucleotides 121385 to 121401; reverse, CCGCTTCCGCCTCCTC, nucleotides 121438 to 121453; probe, CTCCCAGGGCACCGAC, nucleotides 121412 to 121427) or the LAT 5′ exon and then normalized relative to APRT and Xist cellular controls. A significant decrease in LAT RNA occurs between 0 and 8 hpe (P < 0.05) and remains at low levels through 12 hpe. No significant change in the amount of ICP0 RNA was detected between 0 and 12 hpe.