Drosophila Sex-lethal protein mediates polyadenylation switching in the female germline

Abstract

The Drosophila master sex-switch protein Sex-lethal (SXL) regulates the splicing and/or translation of three known targets to mediate somatic sexual differentiation. Genetic studies suggest that additional target(s) of SXL exist, particularly in the female germline. Surprisingly, our detailed molecular characterization of a new potential target of SXL, enhancer of rudimentary (e(r)), reveals that SXL regulates e(r) by a novel mechanism--polyadenylation switching--specifically in the female germline. SXL binds to multiple SXL-binding sites, which include the GU-rich poly(A) enhancer, and competes for the binding of CstF64 in vitro. The SXL-binding sites are able to confer sex-specific poly(A) switching onto an otherwise nonresponsive polyadenylation signal in vivo. The sex-specific poly(A) switching of e(r) provides a means for translational regulation in germ cells. We present a model for the SXL-dependent poly(A) site choice in the female germline.

Figure 1

Female germline-specific poly(A) site switching accounts for the sex-specific isoforms of e(r). (A) (Top) Schematics of the two known transcripts of e(r), which differ with respect to inclusion/exclusion of exon 2 and use of alternative polyadenylation sites (Wojcik et al, 1994). Lines, introns; boxes, exons; shaded boxes, coding regions; (A)n, poly(A) tail; and SXL, potential SXL-binding sites. (i) Sequence of the 3′ end of intron 1. The potential SXL-binding site is underlined. (ii) Sequence of a portion of the 3′UTR region of e(r). Boxed nucleotides, alternative polyadenylation signals; asterisks, cleavage/polyadenylation sites; underlined nucleotides, potential SXL-binding sites (1, 2, and 3); dashed line above the sequence, potential GU-rich enhancer/CstF-64-binding sites (1 and 4). Lowercase residues downstream of the distal (D_A) poly(A) site were sequenced in this study. (B) Exon 2 is alternately spliced, but not in a sex-specific manner. RNase protection was performed using labeled probes, shown at the bottom, corresponding to either exons 1 and 3 or 1, 2, and 3. Positions of the intact probes and relevant protected fragments are shown on the right. (C) The female-specific e(r)-fs transcript uses the downstream poly(A) site. A Northern blot with poly(A)⁺ RNA from male and female flies (lanes 1 and 2) was probed with either the e(r) cDNA or the fs-UTR probe corresponding to the sequence between the two poly(A) sites (P_A and D_A), represented by asterisks in (A(ii)). For this and subsequent figures, XY and XX indicate chromosomal sex. rp49 is a loading control. (D) The e(r)-fs transcript is primarily expressed in the ovaries of mature but not newly eclosed females. Northern blot of RNA isolated from newly eclosed (<2 h) adult XX flies (lane 1), 2- to 3-day-old adult XX flies (lane 2), isolated ovaries (lane 3), and the bulk somatic tissue (whole flies minus ovaries) of XX flies (lane 4). (E) (Top) Loss of the female germline results in the disappearance of the e(r)-fs transcript (lane 4). The poly(A)+ RNA was isolated from the progeny of tud mothers, and probed with the same probes as in panel C.

Figure 2

SXL function in germ cells is necessary for the sex-specific poly(A) switching of e(r). (Left panel) XX flies homozygous for the snf¹⁶²¹ or snf¹⁴⁸ alleles, which disrupt SXL synthesis in the germline, do not express e(r)-fs (lanes 1 and 3). Expression of the SXL cDNA in snf mutant backgrounds under the control of the otu promoter restores the synthesis of the e(r)-fs transcript (lanes 2 and 4). Sxl^f4 and Sxl^f5 homozygotes show a loss of e(r)-fs expression (lanes 7 and 8). (Right panel) Schematics of SXL-related events and their disruption by specific mutations in the female germline. Disruption of SXL synthesis/function by mutations in Sxl or snf leads to female sterility, whereas expression of the Sxl cDNA under the control of the germline-specific otu promoter (otu∷Sxl) restores fertility in snf flies. Lanes 5–8 were not analyzed with the fs-UTR probe.

Figure 3

The SXL-binding site is important for the sex-specific poly(A) switching of e(r). (Top) The order of the two poly(A) sites and the proximal GU-rich element are important for default polyadenylation in males. Northern analysis was performed using an EGFP probe on three independent transgenic lines for each construct. w¹¹¹⁸ is the parental line without the EGFP transgene. (Bottom) Schematics of reporter constructs with the e(r) promoter (site of transcription is indicated by an arrow upstream of EGFP) and different 3′UTRs of e(r) used to generate various transgenic lines. P and D represent the proximal (gray box) and distal (white box) portions of the 3′UTR, respectively. Locations of the proximal (P_A), distal (D_A), duplicated distal (D_A′), and modified distal (D_1A and D_123A) poly(A) sites are shown. The GU-rich elements (1, 2, 3, and 4) are as in Figure 1A(ii). In the DP construct, the SXL-binding site is downstream of the P sequence and is indicated by the black box labeled 1. The asterisk indicates mutation of the proximal GU-rich element. The wt sequence of the proximal GU-rich element (Figure 1A(ii), 1) was changed to TGTTTTAGCACACACCACACGAATTCACACAACAC in mutant1 or to TGTGTGTGTTGAATTCGTG in mutant2. Lane 17 is an overexposure of lane 14.

Figure 4

SXL competes with CstF-64 for binding to the proximal GU-rich element in vitro. (A) (i) Radiolabeled RNA containing the proximal GU-rich element was crosslinked to specific proteins and analyzed on an SDS–polyacrylamide gel. The concentrations (ng/μl) for SXL and hsCstF-64 were as follows: SXL (i and ii): lane 1, 150.0; lane 5, 1.85; lane 6, 5.5; lane 7, 16.5; lane 8, 50.0; lane 9, 150.0; hsCstF-64 (i): lane 2, 13.8; lane 3, 41.6; lanes 4–9, 125.0; and dmCstF-64 (ii): lane 2, 16.6; lane 3, 50.0; lanes 4–9, 150.0. The mutant2 is as described in Figure 3. Longer exposure is shown because of the weaker signal from dmCstF-64. (B) SXL competes with the human CstF-64 (i) and the putative Drosophila CstF-64 (ii) in the nuclear extract for binding to the proximal GU-rich element. Identity of the human hsCstF-64 protein was confirmed by immunoprecipitation with anti-CstF64 antibodies. (C) RNA affinity selection confirms that the CstF complex assembles on the proximal GU-rich element. The proximal GU-rich element (w), but not a control RNA (c), pulls down both CstF-64 and CstF-77 from the HeLa (i) and S2 (ii) nuclear extracts. A schematic of the 3′UTR and the positions of the RNAs used for affinity selection are shown.

Figure 5

SXL binds to multiple binding sites in e(r). Gel mobility shift analysis with SXL (A) and CstF64 (B, i) using RNAs containing either one (e(r)-GU₁) or three (e(r)-GU₁₂₃) SXL-binding sites, shown in Figure 1A(ii). The transformer non-sex-specific Py-tract (tra-nss Py-tract), a known SXL-binding site (Valcarcel et al, 1993), was used as a positive control. (B, ii) The same RNA-binding reaction as in panel (B, i) except that the RNA–protein complex was crosslinked with UV light and separated on a denaturing SDS–polyacrylamide gel. The concentrations (ng/μl) for SXL and hsCstF-64 were as follows. (A) SXL: lanes 1, 7, and 13, no protein; lanes 2, 8, and 15, 0.34; lanes 3, 9, and 16, 0.68; lanes 4, 10, and 17, 1.37; lanes 5, 8, and 18, 2.75; lanes 6, 12, and 19, 5.5; lane 14, 0.17; and (B, i and ii) hsCstF-64: lanes 1 and 8, no protein; lanes 2 and 9, 1.7; lanes 3 and 10, 5.1; lanes 4 and 11, 15.3; lanes 5 and 12, 46.0; lanes 6 and 13, 140.0; lanes 7 and 14, 420.0.

Figure 6

The female-specific portion of e(r) represses translation in vivo. (A) Different portions of the 3′UTR of e(r) (P, D, P+D) (see Materials and methods for details) and control 3′UTRs (Adh, K10) were placed downstream of an EGFP reporter under the control of the e(r) promoter, and analyzed for reporter translation in vivo using fluorescence microscopy (left panels) and immunostaining with anti-GFP antibodies (middle panels) in isolated ovaries. DAPI staining (right panels) is also shown. (B) Northern analysis of RNA from the transgenic lines.

Figure 7

A model for sex-specific polyadenylation site switching of e(r) in the female germline. (−SXL), CstF-64 binds to the proximal GU-rich element and promotes assembly of the polyadenylation machinery preferentially at the proximal site, producing the e(r)-nss isoform. (+SXL), SXL competes with CstF-64 for binding to the proximal GU-rich element, leading to the activation of the distal poly(A) site. The e(r)-nss transcript is translated in the female germline, but e(r)-fs isoform is not; SXL may also be involved in translation repression. Thick arrows indicate the preferred (proximal (P_A) or distal (D_A)) cleavage/polyadenylation sites.