Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1990 Jun;93(2):572-7.
doi: 10.1104/pp.93.2.572.

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

D E Somers  1 , T Caspar, P H Quail
Affiliations

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

D E Somers et al. Plant Physiol. 1990 Jun.

Abstract

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

PubMed Disclaimer

References

    1. Plant Cell. 1989 Jul;1(7):691-698 - PubMed
    1. Plant Cell. 1989 Jul;1(7):681-90 - PubMed
    1. Science. 1986 May 30;232(4754):1106-12 - PubMed
    1. Anal Biochem. 1983 Jul 1;132(1):6-13 - PubMed
    1. Mol Gen Genet. 1989 Jun;217(2-3):240-5 - PubMed

LinkOut - more resources