Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana
- PMID: 16667505
- PMCID: PMC1062552
- DOI: 10.1104/pp.93.2.572
Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana
Abstract
We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.
References
LinkOut - more resources
Full Text Sources
Other Literature Sources
Molecular Biology Databases