Sequence analysis and organization of the Neodiprion abietis nucleopolyhedrovirus genome

Abstract

Of 30 baculovirus genomes that have been sequenced to date, the only nonlepidopteran baculoviruses include the dipteran Culex nigripalpus nucleopolyhedrovirus and two hymenopteran nucleopolyhedroviruses that infect the sawflies Neodiprion lecontei (NeleNPV) and Neodiprion sertifer (NeseNPV). This study provides a complete sequence and genome analysis of the nucleopolyhedrovirus that infects the balsam fir sawfly Neodiprion abietis (Hymenoptera, Symphyta, Diprionidae). The N. abietis nucleopolyhedrovirus (NeabNPV) is 84,264 bp in size, with a G+C content of 33.5%, and contains 93 predicted open reading frames (ORFs). Eleven predicted ORFs are unique to this baculovirus, 10 ORFs have a putative sequence homologue in the NeleNPV genome but not the NeseNPV genome, and 1 ORF (neab53) has a putative sequence homologue in the NeseNPV genome but not the NeleNPV genome. Specific repeat sequences are coincident with major genome rearrangements that distinguish NeabNPV and NeleNPV. Genes associated with these repeat regions encode a common amino acid motif, suggesting that they are a family of repeated contiguous gene clusters. Lepidopteran baculoviruses, similarly, have a family of repeated genes called the bro gene family. However, there is no significant sequence similarity between the NeabNPV and bro genes. Homologues of early-expressed genes such as ie-1 and lef-3 were absent in NeabNPV, as they are in the previously sequenced hymenopteran baculoviruses. Analyses of ORF upstream sequences identified potential temporally distinct genes on the basis of putative promoter elements.

FIG. 1.

Linear sequence map and HindIII physical map of the circular NeabNPV genome. The transcriptional direction of each ORF is represented by an arrow labeled with the ORF number. Known baculovirus predicted homologues are presented below the ORF numbers. Repeat regions (rep) are shown as triangles. Repeat regions depicted in Fig. 2 are outlined with dotted lines.

FIG. 2.

Loci of the NeabNPV genome with repeating elements. The triangles represent the repeated core element in the direction indicated by the point. The name and genome location of the repeat region are indicated on the right, and the repeat element consensus sequences are as follows: A, ATAAAAAACAGTAAATATT(C/T)CAATACGATGC AAACGCACGTGATTAATGT; B, TCAG(A/C)ATTGTCGTTGTTGTTTT(G/C)AG TGTTTTCTGT(G/A)TTATTTC; C, AGATGTCGCGTTTGTTGGGCTCGAGGT CCAACACATTTGACAAGTTG. White arrows indicate the orientation and location of NeabNPV ORFs depicted in Fig. 4.

FIG. 3.

Genome parity plots. Genome plots were derived by comparing (A) NeabNPV against itself, (B) NeabNPV against NeleNPV, (C) NeabNPV against NeseNPV, and (D) NeleNPV against NeseNPV. The axes are labeled with the genome name and the distance (in base pairs). The interspersed repeat sites of NeabNPV are labeled on plots A and B. Triangles above plots A and B represent the locations of interspersed repeats 1 to 7.

FIG. 4.

Alignment of conserved motifs repeated in multiple predicted ORFs of the NeabNPV and NeleNPV genomes. Gaps in the alignment are indicated by dashes, and conserved amino acids are outlined.