PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

Abstract

PrimerStation (http://ps.cb.k.u-tokyo.ac.jp) is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly.

Figure 1

The relationship between the hybridization ratio and temperature. The horizontal axis denotes the temperature and the vertical axis the hybridization ratio. The red line depicts the hybridization ratio of the primer to the target sequence. The black lines show the hybridization ratio of the primer to the off-target sequences. The primer and target sequences are TCGCCAGGAAGTAACTGGGAGCAG and the off-target sequences are (a) CAGCTCCCAGTTACTCCCAGGCTG, (b) CTGCCCCCAGTTCCCTCCTGGAGG, (c) CTGCTCCCAGTTATTTCCTGGTGG, and (d) TGGGCAGGGAGGTACTGGGAGCAG. The blue region indicates the executable temperatures at which the hybridization ratio exceeds 0.99 to the target sequence and the hybridization ratios to the off-targets are no more than 0.05.

Figure 2

Multiplex genomic PCR. Lanes b–q are the electrophoresis results of multiplex genomic PCR on the human ChrX. Ten primers were used, and the multiplicity of primers for each result is (b–k) 1, (l–n) 3, (o and p) 5 and (q) 10. Primers were mixed before PCR amplification. The bands in lanes a and r are ladder markers. Observe that the designed primers amplified a single target sequence from the human genome, and that primers b–k amplified highly specific bands.

Figure 3

Flowchart of multiplex primer design using PrimerStation. (A) Input arbitrary gene IDs that represent target genomic sequence positions. Subsequently, provide primer conditions, such as the product size range, the minimum product size differences, and the avoidance of known SNPs, and (A)_n or (CA)_n repeats. The cation concentration and primer concentration are also adjustable. (B) The result of multiplex PCR primer design. The upper area shows primer information including GeneID, the target chromosome and position, forward and reverse primer sequences, the product size, melting temperatures of forward and reverse primers, second maximum hybridization ratio, minimum executable temperature and free energy changes for the most stable secondary structures of the primers. The lower area shows product information. The product that would be amplified by the designed primer is highlighted in black, and the surrounding sequences are colored gray.