Conformation of an RNA pseudoknot
- PMID: 1696318
- PMCID: PMC7131512
- DOI: 10.1016/0022-2836(90)90192-O
Conformation of an RNA pseudoknot
Abstract
The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.
Similar articles
-
Structure of the autoregulatory pseudoknot within the gene 32 messenger RNA of bacteriophages T2 and T6: a model for a possible family of structurally related RNA pseudoknots.Biochemistry. 1996 Apr 2;35(13):4187-98. doi: 10.1021/bi9527350. Biochemistry. 1996. PMID: 8672455
-
Determining local conformational variations in DNA. Nuclear magnetic resonance structures of the DNA duplexes d(CGCCTAATCG) and d(CGTCACGCGC) generated using back-calculation of the nuclear Overhauser effect spectra, a distance geometry algorithm and constrained molecular dynamics.J Mol Biol. 1990 Aug 5;214(3):711-36. doi: 10.1016/0022-2836(90)90288-W. J Mol Biol. 1990. PMID: 2167379
-
Solution conformation of an oligonucleotide containing a G.G mismatch determined by nuclear magnetic resonance and molecular mechanics.Nucleic Acids Res. 1991 Dec 25;19(24):6771-9. doi: 10.1093/nar/19.24.6771. Nucleic Acids Res. 1991. PMID: 1837078 Free PMC article.
-
Probing the three-dimensional structures of DNA and RNA oligonucleotides in solution by nuclear Overhauser enhancement measurements.FEBS Lett. 1985 Jan 7;179(2):187-98. doi: 10.1016/0014-5793(85)80516-0. FEBS Lett. 1985. PMID: 2981703 Review.
-
The solution structure of yeast tRNAPhe as studied by nuclear Overhauser effects in NMR.J Biomol Struct Dyn. 1983 Oct;1(1):183-207. doi: 10.1080/07391102.1983.10507434. J Biomol Struct Dyn. 1983. PMID: 6401111 Review.
Cited by
-
Structural elements in RNA.Prog Nucleic Acid Res Mol Biol. 1991;41:131-77. doi: 10.1016/s0079-6603(08)60008-2. Prog Nucleic Acid Res Mol Biol. 1991. PMID: 1715587 Free PMC article. Review.
-
Solution structure of the cap-independent translational enhancer and ribosome-binding element in the 3' UTR of turnip crinkle virus.Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1385-90. doi: 10.1073/pnas.0908140107. Epub 2010 Jan 7. Proc Natl Acad Sci U S A. 2010. PMID: 20080629 Free PMC article.
-
An RNA pseudoknot in the 3' end of the arterivirus genome has a critical role in regulating viral RNA synthesis.J Virol. 2007 Sep;81(17):9426-36. doi: 10.1128/JVI.00747-07. Epub 2007 Jun 20. J Virol. 2007. PMID: 17581985 Free PMC article.
-
Use of ultra stable UNCG tetraloop hairpins to fold RNA structures: thermodynamic and spectroscopic applications.Nucleic Acids Res. 1995 Aug 11;23(15):3056-63. doi: 10.1093/nar/23.15.3056. Nucleic Acids Res. 1995. PMID: 7544890 Free PMC article.
-
The use of non-uniform deuterium labelling ['NMR-window'] to study the NMR structure of a 21mer RNA hairpin.Nucleic Acids Res. 1996 Apr 1;24(7):1187-94. doi: 10.1093/nar/24.7.1187. Nucleic Acids Res. 1996. PMID: 8614618 Free PMC article.
References
-
- Akins R.A., Lambowitz A.M. Cell. 1987;50:331–345. - PubMed
-
- Altona C. Recl. Trav. Chim. Pays-Bas. 1982;101:413–434.
-
- Arnott S., Hukins D.W.L., Dover S.D., Fuller W., Hodgson A.R. J. Mol. Biol. 1973;81:107–122. - PubMed
-
- Auron P.E., Weber L.D., Rich A. Biochemistry. 1982;21:4700–4706. - PubMed
-
- Bax A., Lerner L. J. Magn. Reson. 1988;79:429–438.
Publication types
MeSH terms
Substances
Grants and funding
LinkOut - more resources
Full Text Sources
