Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1990 Jul 20;214(2):437-53.
doi: 10.1016/0022-2836(90)90192-O.

Conformation of an RNA pseudoknot

Affiliations

Conformation of an RNA pseudoknot

J D Puglisi et al. J Mol Biol. .

Abstract

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

PubMed Disclaimer

References

    1. Akins R.A., Lambowitz A.M. Cell. 1987;50:331–345. - PubMed
    1. Altona C. Recl. Trav. Chim. Pays-Bas. 1982;101:413–434.
    1. Arnott S., Hukins D.W.L., Dover S.D., Fuller W., Hodgson A.R. J. Mol. Biol. 1973;81:107–122. - PubMed
    1. Auron P.E., Weber L.D., Rich A. Biochemistry. 1982;21:4700–4706. - PubMed
    1. Bax A., Lerner L. J. Magn. Reson. 1988;79:429–438.

Publication types

LinkOut - more resources