Characterization of the short isoform of Helios overexpressed in patients with T-cell malignancies

Abstract

In an earlier report, we demonstrated overexpression of a short isoform of Helios, Hel-5, which lacks three of four N-terminal zinc fingers, in patients with adult T-cell leukemia/lymphoma. Here, we characterized Hel-5 using immunoprecipitation, and gel shift and luciferase promoter assays, and found that Hel-5 lacks the repressor function observed with a full-length isoform of Helios. Moreover, Hel-5 associates with the full-length isoforms of the Ikaros gene family, Ikaros, Aiolos and Helios, and inhibits their DNA binding activity when present in excess, leading to dominant-negative effects on the full-length isoforms of the Ikaros gene family. Our results suggest a critical role for Helios in the mechanism of leukemogenesis.

Figure 1

Diagrammatic representation of (a) Ikaros and (b) Helios isoforms. The four N‐terminal zinc fingers and the two C‐terminal zinc fingers are shown as solid perpendicular boxes.

Figure 2

Homo‐ and heterodimerization of the Ikaros gene family. Constructs containing genes encoding tagged full‐length isoforms of Ikaros, Aiolos or Helios (Ik‐1, Aiolos or Hel‐1, respectively), which are shown in the box, and the short isoforms of Ikaros or Helios (Ik‐6 or Hel‐5) were expressed in 293T cells. Heterodimerization of (a) Hel‐1/Ik‐1 or Ik‐6 (lanes 1 and 2) and (b) Ik‐1/Hel‐1 or Hel‐5 (lanes 1 and 2) were demonstrated by precipitation with anti‐hemagglutinin (HA) antibody. Homodimerization of Ikaros or Helios proteins were also demonstrated by precipitation with anti‐HA antibody: (a) lane 3, (b) lane 3. Heterodimerization of (a) Ikaros/Aiolos (lanes 4 and 5) and (b) Aiolos/Helios (lanes 4 and 5) were demonstrated by precipitation with anti‐FLAG antibody. Anti‐Ikaros or ‐Helios antibody was used to detect (a) Ik‐1 and Ik‐6 or (b) Hel‐1 and Hel‐5 in precipitated complexes.

Figure 3

DNA binding properties of the Ikaros gene family. Ikaros gene family proteins bind the same DNA sequence (Ik‐BS4: tcagcttttgggaatgtattccctgtca) with high affinity. The shifted bands are indicated by arrows. Consistent amounts of full‐length isoforms of Ikaros, Aiolos or Helios (Ik‐1, Aiolos or Hel‐1, respectively) and increasing amounts of the short isoforms of Ikaros or Helios (Ik‐6 or Hel‐5, respectively) were expressed in 293T cells, and whole‐cell lysates were extracted. The molar ratios of full‐length and short isoforms are shown.

Figure 4

Repressor functions of the Ikaros gene family. Full‐length isoforms of (a) Ikaros, (b) Aiolos or (c) Helios (Ik‐1, Aiolos or Hel‐1, respectively) were cotransfected with a reporter vector, 4xIkBS2‐TK‐Luc (TK) or 4xIkBS2‐SV40‐Luc (SV40), and an internal control vector. The empty vector was used to supplement the total amounts of transfected expression vector, and the molar ratios are shown. Promoter activity was calculated as the firefly luciferase activity of the reporter vector divided by the renilla luciferase activity of the control vector.

Figure 5

Loss of repressor function of short isoforms of the Ikaros gene family. The same amounts of the empty vector, the short isoform of the Ikaros gene family, (a) Ik‐6 or (b) Hel‐5, or the full‐length isoform of the Ikaros gene family, (a) Ik‐1 or (b) Hel‐1, were cotransfected with a reporter vector, 4xIkBS2‐TK‐Luc (TK) or 4xIkBS2‐SV40‐Luc (SV40), and an internal control vector. Promoter activity was calculated as the firefly luciferase activity of the reporter vector divided by the renilla luciferase activity of the control vector. Statistical analysis was carried out using Student's t‐test (n = 5).

Figure 6

Functional interactions between full‐length isoforms of the Ikaros gene family and a short isoform, Ik‐6. Full‐length isoforms of (a) Ikaros, (b) Aiolos or (c) Helios (Ik‐1, Aiolos or Hel‐1, respectively) and a short isoform of Ikaros (Ik‐6) were cotransfected with a reporter vector, 4xIkBS2‐TK‐Luc (TK) or 4xIkBS2‐SV40‐Luc (SV40), and an internal control vector. The empty vector was used to supplement the total amounts of transfected expression vector, and the molar ratios are shown. Promoter activity was calculated as the firefly luciferase activity of the reporter vector divided by the renilla luciferase activity of the control vector.

Figure 7

Functional interactions between full‐length isoforms of the Ikaros gene family and a short isoform, Hel‐5. Full‐length isoforms of (a) Ikaros, (b) Aiolos or (c) Helios (Ik‐1, Aiolos or Hel‐1, respectively) and a short isoform of Helios (Hel‐5) were cotransfected with a reporter vector, 4xIkBS2‐TK‐Luc (TK) or 4xIkBS2‐SV40‐Luc (SV40), and an internal control vector. The empty vector was used to supplement the total amounts of transfected expression vector, and the molar ratios are shown. Promoter activity was calculated as the firefly luciferase activity of the reporter vector divided by the renilla luciferase activity of the control vector.