Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2007;46(21):3955-8.
doi: 10.1002/anie.200700047.

Design of molecular logic devices based on a programmable DNA-regulated semisynthetic enzyme

Nathan C Gianneschi  1 , M Reza Ghadiri
Affiliations

Design of molecular logic devices based on a programmable DNA-regulated semisynthetic enzyme

Nathan C Gianneschi et al. Angew Chem Int Ed Engl. 2007.
No abstract available

PubMed Disclaimer

Figures

Figure 1
Figure 1
Formation of an intrasterically inactivated DE•DI enzyme complex via directed noncovalent assembly of DNA-tagged enzyme (DE) and inhibitor (DI) modules. The architectural and functional features of DE•DI can be pre-programmed by appropriate encoding of various DNA segments indicated (α-ε).
Figure 2
Figure 2
Programmed enzyme inactivation and reactivation (OFF-and ON switches). Conditions: DE (2 nM), DI (50 nM), D (50 nM), in Tris/HCl (20 mM, pH 7.4), MgCl2 (50 mM), room temperature. Reaction components were mixed at t=0 in the presence of enzyme substrate (80 µM) unless indicated with an asterisk in which the components were incubated for 1 h prior to substrate addition. Product formation (catalytic endolytic cleavage of the peptide substrate) was monitored by a fluorescence plate reader (λex = 365 nm, λem = 460 nm). DE: CGTTTCATAGCAGCGCCAGATGCTGCGCCCATAGTGCTTCCTGC—Enzyme DE2: CGTTTCATAGCAGCGCCATGCGCCCATAGTGCTTCCTG—Enzyme DI1: Inhibitor-GGTGGCGCTGCTATGAAACG DI2: Inhibitor-AAGCACTATGGGCATCTGTGACTAGC DI3: Inhibitor-GTATCTTATCTGTATTCTTA D1: GCAGGAAGCACTATGGGCGCAGCATC D2: GCAGGAAGCACTATGGGCGCAG D3: GCAGGAAGCACTATGGGCGC D4: GTATCTTATCTGTATTCTTAGTATCT D5: CGTTTCATAGCAGCGCCACC D6: GCTAGTCACAGATGCCCATAGTGCTT D7: CAGGAAGCAC D8: TATGGGCGCA Substrate: DABCYL-βAla-Ala-Gly-Leu-Ala-βAla-EDANS
Figure 3
Figure 3
ON-OFF switch cycles via successive additions of DI2 and D6 (50 nM each) to DE (2 nM) in Tris/HCl (20 mM, pH 7.4), MgCl2 (50 mM), in the presence of substrate (80 µM) at room temperature.
Figure 4
Figure 4
Programming enzymes to perform OR, NOR, and AND logic operations. Logic gate architectures: (a) OR gate (DE•DI1); (b) NOR gate (DE); (c) AND gate (DE•DI2•DI1); and (d) AND gate (DE2•DI1). General conditions: DE and DE2 (2 nM), DI1 and DI2 (50 nM), D2, D5, and D6 (50 nM), D7, and D8 (10 nM), substrate (80 µM) in Tris/HCl (20 mM, pH 7.4), MgCl2 (50 mM), room temp. Logic gates were prepared by incubating the appropriate DE and DI strands for 30 min prior to input addition. Substrate was added simultaneously with input strands, except for the NOR gate which was incubated with inputs for 30 min prior to substrate addition. See SI Figures 4S–7S for full time course data and control studies.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Arkin A, Ross J. Biophys. J. 1994;67:560–578. - PMC - PubMed
    2. Bray D. Nature. 1995;376:307–312. - PubMed
    1. Bieth J, Vratsanos SM, Wassermann N, Erlanger BF. Proc. Natl. Acad. Sci. U.S.A. 1969;64:1103–1106. M. A. Wainberg, B. F. Erlanger, Biochemistry 1971, 10, 3816–3819. - PMC - PubMed
    2. Berezin IV, Varfolomeev SD, Klibanov AM, Martinek K. FEBS Lett. 1974;39:329–331. - PubMed
    3. Corey DR, Schultz PG. J. Biol. Chem. 1989;264:3666–3669. - PubMed
    4. Westmark PR, Kelly JP, Smith BD. J. Am. Chem. Soc. 1993;115:3416–3419.
    5. Stayton PS, Shimoboji T, Long C, Chilkoti A, Chen G, Harris JM, Hoffman AS. Nature. 1995;378:472–474. - PubMed
    6. Liu D, Karanicolas J, Yu C, Zhang Z, Woolley GA. Bioorg. Med. Chem. Lett. 1997;7:2677–2680.
    7. Doi N, Yanagawa H. FEBS Lett. 1999;453:305–307. - PubMed
    8. Baird GS, Zacharias DA, Tsien RY. Proc. Natl. Acad. Sci. U.S.A. 1999;96:11241–11246. - PMC - PubMed
    9. Posey KL, Gimble FS. Biochemistry. 2002;41:2184–2190. - PubMed
    10. Liu H, Schmidt JJ, Bachand GD, Rizk SS, Looger LL, Hellinga HW, Montemagno CD. Nat. Mater. 2002;1:173–177. - PubMed
    11. Feliu JX, Ferrer-Miralles N, Blanco E, Cazorla D, Sobrino F, Villaverde A. Biochim. Biophys. Acta, Prot. Struct. Mol. Enzy. 2002;1596:212–224. - PubMed
    12. Looger LL, Dwyer MA, Smith JJ, Hellinga HW. Nature. 2003;423:185–190. - PubMed
    13. Dueber JE, Yeh BJ, Chak K, Lim WA. Science. 2003;301:1904–1908. - PubMed
    14. Guntas G, Ostermeier M. J. Mol. Biol. 2004;336:263–273. - PubMed
    15. Bose M, Groff D, Xie J, Brustad E, Schultz PG. J. Am. Chem. Soc. 2006;128:388–389. - PubMed
    1. Corey DR, Schultz PG. Science. 1987;238:1401–1403. - PubMed
    2. Uchiyama Y, Inoue H, Ohtsuka E, Nakai C, Kanaya S, Ueno Y, Ikehara M. Bioconjugate Chem. 1994;5:327–332. - PubMed
    3. Stojanovic MN, De Prada P, Landry DW. ChemBioChem. 2001;2:411–415. - PubMed
    4. Dittmer WU, Reuter A, Simmel FC. Angew. Chem. 2004;116:3634–3637. Angew. Chem. Int. Ed. 2004, 43, 3550–3553. - PubMed
    5. Simon P, Dueymes C, Fontecave M, Decout J-L. Angew. Chem. 2005;117:2824–2827. Angew. Chem. Int. Ed. 2005, 44, 2764–2767. - PubMed
    6. Choi B, Zocchi G, Wu Y, Chan S, Perry LJ. Phys. Rev. Lett. 2005;95:078102. - PubMed
    7. Pavlov V, Shlyahovsky B, Willner I. J. Am. Chem. Soc. 2005;127:6522–6523. - PubMed
    1. Kobe B, Kemp BE. Nature. 1999;402:373–376. - PubMed
    2. Saghatelian A, Guckian KM, Thayer DA, Ghadiri MR. J. Am. Chem. Soc. 2003;125:344–345. - PMC - PubMed
    1. Page MI, Jencks WP. Proc. Natl. Acad. Sci. U.S.A. 1971;68:1678–1683. - PMC - PubMed

Publication types

LinkOut - more resources