MyD88-dependent immune activation mediated by human immunodeficiency virus type 1-encoded Toll-like receptor ligands

Abstract

Immune activation is a major characteristic of human immunodeficiency virus type 1 (HIV-1) infection and a strong prognostic factor for HIV-1 disease progression. The underlying mechanisms leading to immune activation in viremic HIV-1 infection, however, are not fully understood. Here we show that, following the initiation of highly active antiretroviral therapy, the immediate decline of immune activation is closely associated with the reduction of HIV-1 viremia, which suggests a direct contribution of HIV-1 itself to immune activation. To propose a mechanism, we demonstrate that the single-stranded RNA of HIV-1 encodes multiple uridine-rich Toll-like receptor 7/8 (TLR7/8) ligands that induce strong MyD88-dependent plasmacytoid dendritic cell and monocyte activation, as well as accessory cell-dependent T-cell activation. HIV-1-encoded TLR ligands may, therefore, directly contribute to the immune activation observed during viremic HIV-1 infection. These data provide an initial rationale for inhibiting the TLR pathway to directly reduce the chronic immune activation induced by HIV-1 and the associated immune pathogenesis.

FIG. 1.

Correlation of viral load and activation markers upon initiation of HAART in chronic HIV infection. Shown are the simultaneous decay of the plasma viral load (VL) (open squares) and the percentage of activated CD8⁺ T cells (closed triangles) in 10 chronically HIV-infected subjects before and up to 1 year after the initiation of HAART. The dotted line represents the limit of detection for the viral load assay (50 RNA copies/ml). In panel A, the percentage of proliferating Ki67⁺ CD8⁺ cells closely follows the decay in viral loads (r = 0.6391, P < 0.0001, Spearman rank correlation). Similarly, panels B and C show the decline in the percentage of CD8⁺ HLA-DR⁺ cells (r = 0.6466, P < 0.0001) and CD8⁺ CD38⁺ cells (r = 0.6532, P < 0.0001), respectively, in relation to the viral load. All values are presented as median values, and bars represent the interquartile ranges.

FIG. 2.

TNF-α production of human PBMCs in response to HIV-1-derived ssRNA. Shows the production of TNF-α by PBMCs unstimulated (neg), stimulated with different RNA oligonucleotides in the absence or presence of chloroquine, or stimulated with PMA or DOTAP alone. Numbers on the y axis indicate the order of appearance in Table 1 of the RNA oligonucleotides. Strong induction of TNF-α release in human PBMCs was observed following stimulation with HIV-1-derived ssRNA (U-Variants) and described TLR7/8 ligands (3M011 and 3M002) as measured by ELISA. No secretion of TNF-α was induced in response to the U-to-A control oligonucleotides, in which the uridines were replaced by adenosines (A-Variants). The activation of PBMCs induced by U-rich HIV-1 ssRNA oligonucleotides was blocked by chloroquine, a known inhibitor of intracellular TLR signaling (U-Variants + chloroquine). Data represent the results ± standard deviations from four independent experiments.

FIG. 3.

Survival of pDCs and monocytes after 20 h of in vitro culture in the presence or absence of HIV-1-derived ssRNA oligonucleotides. The frequencies of pDCs (CD3^neg CD14^neg CD123^bright+) and monocytes (CD3^neg CD14⁺) in PBMC stimulated with HIV-1-derived ssRNA oligonucleotides (U-Variants) or described TLR7/8 ligands 3M011 and 3M002 after 20 h of culture were significantly higher than those in unstimulated PBMC (neg), PBMC stimulated with the transfection reagent DOTAP alone, or PBMC stimulated with the control U-to-A variants (A-Variants). Data represent the averages ± standard deviations of the results of four independent experiments. *, P = <0.05.

FIG. 4.

Cytokine production by monocytes in response to HIV-1-derived ssRNA oligonucleotides and control ligands 3M011 and 3M002. Flow plots show PBMC gated on CD3^neg CD14⁺ monocytes stained intracellularly for IL-6 (A) and TNF-α (C). HIV-1-derived ssRNA oligonucleotides (U-Variants) induced strong IL-6 and TNF-α production, whereas the control U-to-A sequences (A-Variants) and DOTAP alone induced responses similar to the background activity of unstimulated controls (neg). The graphs show the mean percentages ± standard deviations of IL-6⁺ (B) and TNF-α⁺ (D) monocytes for all tested sequences. Data represent the results from four independent experiments.

FIG. 5.

Cytokine production by pDCs in response to HIV-1-derived ssRNA oligonucleotides and control ligands 3M011 and 3M002. Flow plots show PBMC gated on CD3^neg CD14^neg CD123^bright pDCs stained intracellularly for IFN-α (A) and TNF-α (C). HIV-1-derived ssRNA oligonucleotides (U-Variants) induced strong IFN-α and TNF-α production, whereas the control U-to-A sequences (A-Variants) and DOTAP alone induced responses similar to the background activity of unstimulated controls (neg). The graphs show the mean percentages ± standard deviations of IFN-α⁺ (B) and TNF-α⁺ (D) pDCs for all tested sequences. Data represent the results from four independent experiments.

FIG. 6.

Immune activation by HIV-1-derived ssRNA oligonucleotides is MyD88 dependent and can be blocked by using a TLR7/9 antagonist. (A) TNF-α production, as determined by ELISA, of murine BMDM in C57BL/6 (wild type) and MyD88-KO mice after 20 h of stimulation with HIV-1-derived ssRNAs, the corresponding A variants, control ligands RNA40 and RNA41, Gardiquimod, or LPS, all complexed to DOTAP, or DOTAP alone (neg). Data represent the average results ± standard deviations of three independent experiments, each with pooled BMDM of two MyD88-KO and three C57BL/6 mice. (B to E) Normalized percentages of IFN-α⁺ (B and D) and TNF-α⁺ (C and E) pDCs after 20 h of stimulation with the HIV-1-derived ssRNA oligonucleotides Gag_RNA1166 (B and C) and Vif_RNA327 (D and E) in the absence or presence at increasing concentrations of the described TLR7/9 antagonist IRS954. Cytokine production in the absence of the antagonist was defined as 1. pDCs were defined as CD3^neg CD19^neg CD56^neg CD14^neg CD11c^neg CD123^bright cells. Data represent the average results ± standard deviations from four independent experiments.

FIG. 7.

Activation of CD8 T cells in response to HIV-1-derived TLR ligands. Upregulation of CD69 on CD8⁺ T cells after 6 h of stimulation with HIV-1-derived oligonucleotides. No activation was observed after incubation with the corresponding U-to-A variants or after coincubation with chloroquine. Chloroquine did not suppress the activation induced by PMA-ionomycin (PMA+I). (A) Stimulation of PBMC with two representative HIV-1-derived oligonucleotides, as well as their corresponding U-to-A variants. (B) Mean percentages ± standard deviations of CD69⁺ CD8⁺ T cells following incubation with these nine novel HIV-1-derived oligonucleotides and their corresponding U-to-A variants and after coincubation of the oligonucleotides with chloroquine in five independent experiments. RNA40, GCCCGUCUGUUGUGUCACUC; Poly U, UUUUUUUUUUUUUUUUUUUU.

FIG. 8.

Stimulation of CD8⁺ T cells by HIV-1-derived TLR ligands is dependent on direct cell-to-cell contact with CD14⁺ cells. (A) CD69 expression on highly purified (>98.8%) CD8⁺ T cells after stimulation with RNA40 plus DOTAP, RNA41 plus DOTAP, or 3M002. No upregulation of CD69 was observed on purified CD8⁺ T cells (upper panels). After the adding back of purified CD14⁺ cells, upregulation of CD69 on CD8⁺ T cells was observed following stimulation with RNA40 plus DOTAP and 3M002 (middle panels). When purified CD14⁺ cells were separated from CD8⁺ T cells by a semipermeable membrane in transwell experiments (lower panels), no activation of CD8⁺ T cells was observed. PMA+I, PMA-ionomycin. (B) Average results ± standard deviations from three independent experiments are shown.