Concurrent splicing and transcription are not sufficient to enhance splicing efficiency

Abstract

The concept of a tight integration of transcription and splicing of mRNA precursors has been supported with increasing evidence in recent years. However, the mechanism and functional consequences of this integration remain largely unknown. We have examined how these processes impact upon one another when they occur together in HeLa nuclear extract. While both processes do in fact occur in parallel reactions in the extracts, we found no evidence that one process affects the other, under a variety of conditions tested. For example, neither the kinetics nor efficiency of splicing is significantly enhanced by de novo RNA polymerase II-mediated transcription, relative to that of presynthesized RNA added exogenously to the extract. Our results indicate that the act of transcription by RNA polymerase II in vitro is not sufficient to enhance splicing of the newly made RNA.

FIGURE 1.

Possible levels of integration between transcription and splicing. In a parallel reaction, the splicing-related interaction occurs after pre-mRNA has been released from DNA template. In a concurrent reaction, the splicing-related interactions occur before release, while transcription is still in process, but independently of transcription elongation. In a coupled reaction, splicing is stimulated in a transcription-specific manner.

FIGURE 2.

Properties of in vitro transcription-splicing reactions. (A) Time course of RNAP II transcription in HeLa nuclear extract. Transcription–splicing reactions have been incubated for indicated times. In the right lane, 5′SS RNA was added to a final concentration of 4 μM. (B) Summary of transcription–splicing pulse-chase assays. Here and in all other experiments the extent of splicing was determined by measuring the intensities of relevant phosphorimager bands and calculating the percentage of spliced mRNA relative to the total mRNA at the end of the reaction. The graph represents cumulative data from four independent experiments. (C) Sample transcription–splicing pulse-chase assay. Transcription from elongated β-globin templates (containing a downstream 5′ splice site) was allowed to proceed for 15 min, and the incubations were interrupted; α-amanitin was added to a final concentration of 1 ng/μL in order to inhibit RNAP II in the indicated reactions. The samples were incubated further to the times indicated. (D) Same as C, except that GTP and MgCl₂ were added to final concentrations of 1 mM and 4 mM, respectively, in order to compensate for chelating of Mg²⁺ by GTP. (E) Spermidine concentration screen. Standard transcription–splicing reactions were incubated for a total of 2 h in the presence of different concentrations of spermidine as indicated on the top of the panel.

FIGURE 3.

Comparative time course of transcription–splicing and splicing reactions. (A) Transcription–splicing time course with standard CMV-β globin template. Transcription was allowed to proceed for 15 min and the incubations were interrupted; α-amanitin was added to a final concentration of 1 ng/μL in order to inhibit RNAP II in the indicated reactions. The samples were incubated further for the times indicated. Precursors, products, and intermediates of the transcription–splicing reactions are indicated to the left of the panel. (B) Splicing of T7-synthesized standard β-globin substrate. Precursors, products, and intermediates of the splicing reactions are indicated to the right of the panel. (C) RT-PCR analysis of reactions shown in panel B. (D) RT-PCR analysis of reactions shown in panel A.

FIGURE 4.

5′SS-Mediated inhibition of splicing. Transcription–splicing (A) or splicing (B) reactions were carried out for 2 h in the presence of increasing concentrations of 5′SS RNA oligonucleotide (UCACAGGUAAGUACUUAUUUUCCCAGGCC) or mutated 5′MutSS RNA oligonucleotide (UCACAGCCAAGUACUUAUUUUCCCAGGCC). Oligonucleotide concentrations are indicated on the top of the panels. Precursors, products, and intermediates of the transcription–splicing reactions are indicated to the left of the panel (A), and those of the splicing reactions are indicated to the right of the panel (B).

FIGURE 5.

5′SS-Mediated splicing inhibition and commitment to splicing pathway. (A) Transcription does not facilitate recruitment of splicing factors from complexes that form on 5′SS RNA oligonucleotides. Splicing (left panel) or transcription–splicing reactions (right panel) were either carried out normally (lanes 1,2,5,6) or preincubated for 15 min in the presence (lanes 4,8) or absence of 5′SS RNA oligonucleotide (lanes 3,7). Following preincubation either β-globin RNA or CMV-β globin DNA template was added and the samples were incubated further for a total of 2 h. Precursors, products, and intermediates of the splicing reactions are indicated to the left of the panel, and those of the transcription–splicing reactions are indicated to the right of the panel. (B) Commitment of presynthesized RNA to the splicing pathway. Splicing reactions were allowed to proceed for 5, 10, or 15 min; the incubations were interrupted and 5′SS RNA oligonucleotide was added to 5 μM final concentration, and the samples were incubated further for a total of 2 h. 5′SS RNA was added to one of the reactions at the start of the incubation (0′). Precursors, products, and intermediates of the splicing reactions are indicated to the left of the panel. (C). Same assay as in B with transcription–splicing reactions. Reactions were carried out for the indicated periods of time and were either stopped or the incubation was interrupted and α-amanitin was added to a final concentration of 1 ng/μL or α-amanitin and 5′SS RNA oligonucleotide were added together to 1 ng/μL and 5 μM final concentrations, respectively. Samples were incubated further for a total of 2 h. 5′SS RNA was added to one of the reactions at the start of the incubation (0′). Precursors, products, and intermediates of the transcription splicing reactions are indicated to the left of the panel.

FIGURE 6.

Processing of expanded introns. (A) Transcription–splicing reactions were carried out for 2 h on the β-globin templates encoding RNAs with varying length of the intron (indicated on top of the panel). Where indicated, transcription was allowed to proceed for 15 min, at which point the incubations were interrupted and α-amanitin was added to a final concentration of 1 ng/μL. The samples were incubated further for a total of 2 h. The precursors and products of the splicing reactions are indicated to the left of the panel. (B) The corresponding splicing assay using substrates with varying length of the intron (indicated on top of the panel). Samples were incubated for 2 h. The precursors and products of the splicing reactions are indicated on the left of the panel, except in the case of ßglobin-ΔInt construct (849-nt intron), where precursors and intermediates are indicated on the right.