Steric and electrostatic effects in DNA synthesis by the SOS-induced DNA polymerases II and IV of Escherichia coli

Abstract

The SOS-induced DNA polymerases II and IV (pol II and pol IV, respectively) of Escherichia coli play important roles in processing lesions that occur in genomic DNA. Here we study how electrostatic and steric effects play different roles in influencing the efficiency and fidelity of DNA synthesis by these two enzymes. These effects were probed by the use of nonpolar shape analogues of thymidine, in which substituted toluenes replace the polar thymine base. We compared thymine with nonpolar analogues to evaluate the importance of hydrogen bonding in the polymerase active sites, while we used comparisons among a set of variably sized thymine analogues to measure the role of steric effects in the two enzymes. Steady-state kinetics measurements were carried out to evaluate activities for nucleotide insertion and extension. The results showed that both enzymes inserted nucleotides opposite nonpolar template bases with moderate to low efficiency, suggesting that both polymerases benefit from hydrogen bonding or other electrostatic effects involving the template base. Surprisingly, however, pol II inserted nonpolar nucleotide (dNTP) analogues into a primer strand with high (wild-type) efficiency, while pol IV handled them with an extremely low efficiency. Base pair extension studies showed that both enzymes bypass non-hydrogen-bonding template bases with moderately low efficiency, suggesting a possible beneficial role of minor groove hydrogen bonding interactions at the N-1 position. Measurement of the two polymerases' sensitivity to steric size changes showed that both enzymes were relatively flexible, yielding only small kinetic differences with increases or decreases in nucleotide size. Comparisons are made to recent data for DNA pol I (Klenow fragment), the archaeal polymerase Dpo4, and human pol kappa.

Figure 1

Structures of nonpolar thymidine analogs of varied size used in this study.

Figure 2

Steady-state efficiencies (V_max/K_M) for insertion of natural dNTPs opposite template base analogs of increasing size for DNA pol IV. Note log scale of efficiencies. Primer-template duplexes had the sequence (5′-TAATACGACTCACTATAGGGAGA) · (5′-ACTGXTCTCCCTATAGTGAGTCGTATTA). Kinetics were measured at 37 °C in a buffer containing 20 mM Tris (pH 7.5), 20 mM sodium glutamate, 4% v/v glycerol, 8 mM MgCl₂, and 5 mM DTT. The primer was 5′-end labeled with γ-³²P-ATP and was extended by the polymerase in the presence of a single dNTP over various concentrations and times; products of single nucleotide insertions were resolved from unreacted primer by 20% denaturing polyacrylamide gel electrophoresis and quantified by autoradiography. See Table 1 for numerical data.

Figure 3

The effects of varying base size on DNA pol II. Single nucleotide insertion efficiencies (V_max/K_M) are shown on a log scale. (A) Insertion of natural dNTPs opposite template base analogs of increasing size, with T for comparison. (B) Insertion of nucleoside triphosphate analogs of increasing size opposite natural template bases, with dTTP for comparison. Conditions are the same as for Figure 2. See Tables 2 and 3 for data.

Figure 4

Efficiencies (V_max/K_M) versus base size for extension past an A·X base pair, where X is a nonpolar thymidine of variable size in the template strand. (A) Extension by DNA pol II. (B) Extension by pol IV. Primer-template duplexes had the sequence (5′-TAATACGACTCACTATAGGGAGAA) · (5′-ACTGXTCTCCCTATAGTGAGTCGTATTA). Other conditions are described in the Figure 2 legend. See Tables 4 and 5 for data.

Figure 5

Sketch showing a potential frameshift caused by DNA slippage. (A) Normal nucleotide incorporation geometry. (B) Possible incorporation geometry with unnatural base slipped out, leading to a -1 frameshift mutation. No evidence for the frameshift mode was seen with nonnatural template bases.