A new assay for promoter analysis in Chlamydomonas reveals roles for heat shock elements and the TATA box in HSP70A promoter-mediated activation of transgene expression

Abstract

The aim of this work was to identify cis-regulatory sequences within the Chlamydomonas HSP70A promoter that mediate its stimulatory effect on the expression of downstream promoters. For this, we deleted/mutated the HSP70A promoter and, using a new assay, quantified its stimulatory effect. Our results indicate that the effect is mediated largely by heat shock elements and the TATA box.

FIG. 1.

Quantification of ble mRNA expression and ble transgene levels in pools of Chlamydomonas cotransformants. (A) Analysis of the detection limit for ble transcripts in cotransformant pools. Strains containing an expressing copy of Δ-285AR-ble (Fig. 2) or a nonexpressing copy of R-ble were grown to a density of 5 × 10⁶ cells/ml. Cells containing the nonexpressed construct were mixed with the indicated percentage of cells containing the expressed construct. Total cellular RNA was isolated, separated on agarose gels, and transferred to nylon membranes. Membranes were hybridized with a probe detecting the 3′ part of the ble coding region, stripped, and rehybridized with a probe generated from the ∼1-kb CBLP cDNA (16). Hybridization signals were quantified with the QuantityOne 4.5.1 program (Bio-Rad, Munich, Germany). ble signal values were corrected for unequal loading by values obtained for the constitutively expressed CBLP and plotted against the percentage of ble transgene-expressing cotransformants in the cell culture. Values represent the averages from two independent experiments. (B) Analysis of the correlation between ble transgene signals and number of ble transgene-containing colonies. Chlamydomonas cells containing or lacking a single-copy ble transgene were spread onto TAP agar plates, and colonies were grown and counted. About 500 colonies of cells containing the ble transgene were scraped from the agar plates and inoculated alone (100%) or together with the indicated percentage of colonies lacking the ble transgene (20 to 50%). In addition, 800 colonies of the strain lacking the ble transgene were inoculated (0%). After overnight growth in liquid TAP medium, total cellular DNA was extracted, digested with PvuII and BamHI, separated on agarose gels, transferred to nylon membranes, and hybridized with probes against ble or RBCS2. ble and RBCS2 signals were quantified, and ble signal values, corrected for loading by the RBCS2 signal, were plotted against the percentage of ble transgene-containing colonies.

FIG. 2.

Analysis of heat shock inducibility and activation of transgene expression by AR-ble constructs. The ble gene is shown as a black bar. Gray lines indicate RBCS2 sequences, i.e., the promoter including 182 bp upstream from the transcriptional start site (+1), the 5′ untranslated region, the first intron, and the 3′ untranslated region. HSP70A promoter sequences were cloned upstream from the R promoter in the orientation (−4) that resulted in most efficient activation of the R promoter (14). A promoter deletion end points are given relative to the translational start codon. The transcriptional start site indicated (+1) is that of promoter part P_A1 situated 89 bp upstream from the translational start codon (15). Sequence motifs highlighted within the A promoter are a CCAAT box (C), three inverted CCAAT boxes (C_i), four HSEs (I to IV, large black boxes (8), and the TATA box (T, small black box). Gray boxes designate mutated HSEs/TATA, which destroy the canonical nGAAn/nTTCn and TATAA motifs as follows: HSE1, GCGTCCAGAAGGCGCCATACGG→GacgagctctGGCGCCATACGG; HSE2, GGGGAAGCTCTGGAAGGGCCGCGATGG→GGGGtAtCagatctcGGGCtGCtATGG; HSE3, ATGAAGCTACAGGACTG→ATtctGCgACgtcACTG; HSE4, GCGAAGGGCCGCGACGGTTCGAGAACCGACTTGAGGG→GCattGGGCCGCtcCGGagatctAgCCGACTTtAGGG; and TATA, GGTATAAAAG→GGgAcgtcAG (underlining indicates the position of the motif within a sequence, boldfaced nucleotides match the canonical motif, wild-type sequences are in uppercase, and introduced mutations are in lowercase). Constructs are drawn to scale; to accommodate Δ-843, it is drawn as a hairpin. For the analysis of heat shock inducibility, ≥500 zeocin-resistant transformants for each experiment were grown overnight in continuous light; half of the cells were harvested directly (CL), the other half were heat shocked (HS) at 40°C for 30 min. Total RNA was extracted, separated on agarose gels, and transferred to nylon membranes. Membranes were hybridized with the ble probe, stripped, and rehybridized with the CBLP probe. ble signals, including both R and A promoter-derived messages, were quantified and corrected for loading by the CBLP signal. Total ble signal values from heat-shocked cells were divided by the values from nonstressed cells. Given are the averages from three independent experiments ± standard errors of the means. For expression analysis, at least 260 cotransformants were grown overnight in liquid TAP medium. Total RNA and DNA were extracted, separated on agarose gels, and transferred to nylon membranes. Prior to electrophoresis, DNA was digested with PvuII and BamHI. RNA blots were hybridized with the ble probe, stripped, and rehybridized with the CBLP probe. Quantified ble signals were corrected for loading by the CBLP signal. DNA gel blots were hybridized with the ble probe, stripped, and rehybridized with a 263-bp probe derived from sequences upstream from the RBCS2 regulatory sequences (8). Quantified ble signals were corrected for loading by the RBCS2 signal. Corrected ble signal values from RNA blots were divided by corrected ble signal values from DNA blots. Ratios obtained for each construct type were then divided by that from the R-ble construct (pSP115 [9]), which was arbitrarily set to 1.0. Given are the averages from three to eight experiments ± standard errors of the means.